Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001132 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DDX54 |
| Origin species: | Human |
| Product name: | DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene |
| Size: | 2ug |
| Accessions: | BC001132 |
| Gene id: | 79039 |
| Gene description: | DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 |
| Synonyms: | ATP-dependent RNA helicase DDX54; ATP-dependent RNA helicase DP97; DEAD (Asp-Glu-Ala-Asp) box polypeptide 54; DEAD box RNA helicase 97 kDa; DEAD box helicase 97 KDa; DEAD box protein 54; DEAD-box helicase 54 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacctcggatgtggagccggacacccgggagatggtgcgtgcccagaacaagaagaagaagaagtctggaggcttccagtccatgggcctgagctacccggtgttcaaaggcatcatgaagaagggggagcctttgagcagcaggcagctggcgctgtcctggacttgatgggggatgaagcccagaacctgacgaggggccggcagcagctcaagtgggaccgtaagaagaagcggtttgtgggacagtcaggacaggaagacaagaagaagattaagacagagagcggccgctacatcagcagctcctacaagcgagacctctatcagaagtggaaacagaaacagaaaattgatgatcgtgactcggacgaagaaggggcatctgaccggcgaggcccagagcgaagaggtgggaagcgagaccgtggccaagcaggtgcatcccggccccacgccccaggcacccctgcaggccgagtccgcccggaactcaagaccaagcagcagatcctgaagcagcggcgccgggcccagaagctgcacttcctgcagcgtggtggcctcaagcagctctctgcccgcaaccgccgccgcgtccaggagctgcagcagggcgccttcggccggggtgcccgctccaagaagggcaagatgcggaagaggatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 6 - FGGY carbohydrate kinase domain containing - serine peptidase inhibitor, Kazal type 1 - ankyrin repeat domain 1 (cardiac muscle) |