DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene View larger

DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001132
Product type: DNA & cDNA
Ncbi symbol: DDX54
Origin species: Human
Product name: DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene
Size: 2ug
Accessions: BC001132
Gene id: 79039
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms: ATP-dependent RNA helicase DDX54; ATP-dependent RNA helicase DP97; DEAD (Asp-Glu-Ala-Asp) box polypeptide 54; DEAD box RNA helicase 97 kDa; DEAD box helicase 97 KDa; DEAD box protein 54; DEAD-box helicase 54
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcacctcggatgtggagccggacacccgggagatggtgcgtgcccagaacaagaagaagaagaagtctggaggcttccagtccatgggcctgagctacccggtgttcaaaggcatcatgaagaagggggagcctttgagcagcaggcagctggcgctgtcctggacttgatgggggatgaagcccagaacctgacgaggggccggcagcagctcaagtgggaccgtaagaagaagcggtttgtgggacagtcaggacaggaagacaagaagaagattaagacagagagcggccgctacatcagcagctcctacaagcgagacctctatcagaagtggaaacagaaacagaaaattgatgatcgtgactcggacgaagaaggggcatctgaccggcgaggcccagagcgaagaggtgggaagcgagaccgtggccaagcaggtgcatcccggccccacgccccaggcacccctgcaggccgagtccgcccggaactcaagaccaagcagcagatcctgaagcagcggcgccgggcccagaagctgcacttcctgcagcgtggtggcctcaagcagctctctgcccgcaaccgccgccgcgtccaggagctgcagcagggcgccttcggccggggtgcccgctccaagaagggcaagatgcggaagaggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 6
- FGGY carbohydrate kinase domain containing
- serine peptidase inhibitor, Kazal type 1
- ankyrin repeat domain 1 (cardiac muscle)

Buy DDX54-DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene now

Add to cart