FGGY-FGGY carbohydrate kinase domain containing Gene View larger

FGGY-FGGY carbohydrate kinase domain containing Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGGY-FGGY carbohydrate kinase domain containing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGGY-FGGY carbohydrate kinase domain containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000610
Product type: DNA & cDNA
Ncbi symbol: FGGY
Origin species: Human
Product name: FGGY-FGGY carbohydrate kinase domain containing Gene
Size: 2ug
Accessions: BC000610
Gene id: 55277
Gene description: FGGY carbohydrate kinase domain containing
Synonyms: FGGY carbohydrate kinase domain containing; FGGY carbohydrate kinase domain-containing protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccagatgccagagtatatatgcatatttgaacagtcacctggatctgattaagaaggctcagcctgtgggtttccttactgttgatttacatgtttggccagatttccatggcaaccggtctcccttagcagatctgacactaaagggcatggtcaccggattgaaactgtctcaggaccttgatgatcttgccattctctacctggccacagttcaagccattgctttggggactcgcttcattatagaagccatggaggcagcagggcactcaatcagtactcttttcctatgtggaggcctcagcaagaatcccctttttgtgcaaatgcatgcggacattactggcatgcctgtggtcctgtcgcaagaggtggagtccgttcttgtgggtgctgctgttctgggtgcctgtgcctcaggggatttcgcttctgtacaggaagcaatggcaaaaatgagcaaagttgggaaagttgtgttcccgagactacaggataaaaaatactatgataagaaataccaagtattcctgaagctggttgaacaccagaaggagtatttggcgatcatgaatgatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine peptidase inhibitor, Kazal type 1
- ankyrin repeat domain 1 (cardiac muscle)
- glycerol-3-phosphate dehydrogenase 1-like
- zinc finger and BTB domain containing 37

Buy FGGY-FGGY carbohydrate kinase domain containing Gene now

Add to cart