Login to display prices
Login to display prices
ZBTB37-zinc finger and BTB domain containing 37 Gene View larger

ZBTB37-zinc finger and BTB domain containing 37 Gene

PTXBC003116

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZBTB37-zinc finger and BTB domain containing 37 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB37-zinc finger and BTB domain containing 37 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003116
Product type: DNA & cDNA
Ncbi symbol: ZBTB37
Origin species: Human
Product name: ZBTB37-zinc finger and BTB domain containing 37 Gene
Size: 2ug
Accessions: BC003116
Gene id: 84614
Gene description: zinc finger and BTB domain containing 37
Synonyms: D430004I08Rik; ZNF908; zinc finger and BTB domain-containing protein 37; zinc finger and BTB domain containing 37
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaaggtgggaacatacaattggagattcctgacttcagcaactctgtcctgagccatctaaaccagttgcgcatgcagggccgtctctgtgatattgtggtcaatgtgcaaggacaagcttttcgggctcacaaagtggtgctggctgccagctccccctatttccgggatcacatgtccttgaatgagatgagtacagtctccatttcagtcatcaagaaccctactgtttttgaacagctcctttctttctgttacacagggcggatatgcctgcaactggcagatatcatcagctacctaacagctgccagttttctgcaaatgcagcatattatagacaaatgtacacagatcctggagggcattcatttcaaaattaatgtggctgaggttgaagcagaattaagtcaaacaaggacaaagcatcaagagagacctccagagtctcacagggttacaccaaatctcaaccgctcccttagcccacgacataataccccaaagggaaaccggcgaggtcaggttagtgctgtgctggatatcagagagctaagtcctcctgaggagtccaccagccctcagatcattgaaccaagttctgatgtagagagccgggagcccattcttcggatcaaccgagcaggacagtggtatgtggagacaggagtggcggaccgtgggggtcggagtgatgatgaagttagagttcttggagcagtacacatcaaaactgaaaatctggaggagtggcttgggcctgagaatcagccttctggagaagatgggagtagtgcagaggaagtaacagccatggtgattgataccacaggccatggttctgtaggacaggaaaattatactttagggtcttcaggagccaaggtggctcggccaacaagcagtgaagttgacagatttagcccctccggcagtgttgttcccttgacagagagacacagagccagaagtgagtctcctgggagaatggatgagcctaagcaacccagctcccaggtatggagttgtggatttagaactgctttggtggttggaggaattgctactgtgtatgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cholinergic receptor, nicotinic, alpha 3
- golgi autoantigen, golgin subfamily a, 2
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
- zinc finger and BTB domain containing 16