CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene View larger

CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene

PTXBC006114

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006114
Product type: DNA & cDNA
Ncbi symbol: CHRNA3
Origin species: Human
Product name: CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene
Size: 2ug
Accessions: BC006114
Gene id: 1136
Gene description: cholinergic receptor, nicotinic, alpha 3
Synonyms: LNCR2; NACHRA3; PAOD2; neuronal acetylcholine receptor subunit alpha-3; cholinergic receptor, nicotinic alpha 3; cholinergic receptor, nicotinic, alpha 3 (neuronal); cholinergic receptor, nicotinic, alpha polypeptide 3; neuronal nicotinic acetylcholine receptor, alpha3 subunit; cholinergic receptor nicotinic alpha 3 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctctggcccgctctcgctgcccctggcgctgtcgccgccgcggctgctgctgctgctgctgctgtctctgctgccagtggccagggcctcagaggctgagcaccgtctatttgagcggctgtttgaagattacaatgagatcatccggcctgtagccaacgtgtctgacccagtcatcatccatttcgaggtgtccatgtctcagctggtgaaggtggatgaagtaaaccagatcatggagaccaacctgtggctcaagcaaatctggaatgactacaagctgaaatggaacccctctgactatggtggggcagagttcatgcgtgtccctgcacagaagatctggaagccagacattgtgctgtataacaatgctgttggggatttccaggtggacgacaagaccaaagccttactcaagtacactggggaggtgacttggatacctccggccatctttaagagctcctgtaaaatcgacgtgacctacttcccgtttgattaccaaaactgtaccatgaagttcggttcctggtcctacgataaggcgaaaatcgatctggtcctgatcggctcttccatgaacctcaaggactattgggagagcggcgagtgggccatcatcaaagccccaggctacaaacacgacatcaagtacaactgctgcgaggagatctaccccgacatcacatactcgctgtacatccggcgcctgcccttgttctacaccatcaacctcatcatcccctgcctgctcatctccttcctcactgtgctcgtcttctacctgccctccgactgcggtgagaaggtgaccctgtgcatttctgtcctcctctccctgacggtgtttctcctggtgatcactgagaccatcccttccacctcgctggtcatccccctgattggagagtacctcctgttcaccatgatttttgtaaccttgtccatcgtcatcaccgtcttcgtgctcaacgtgcactacagaaccccgacgacacacacaatgccctcatgggtgaagactgtattcttgaacctgctccccagggtcatgttcatgaccaggccaacaagcaacgagggcaacgctcagaagccgaggcccctctacggtgccgagctctcaaatctgaattgcttcagccgcgcagagtccaaaggctgcaaggagggctacccctgccaggacgggatgtgtggttactgccaccaccgcaggataaaaatctccaatttcagtgctaacctcacgagaagctctagttctgaatctgttgatgctgtgctgtccctctctgctttgtcaccagaaatcaaagaagccatccaaagtgtcaagtatattgctgaaaatatgaaagcacaaaatgaagccaaagaggaacaaaaagcccaagagatccaacaattgaaacgaaaagaaaagtccacagaaacatccgatcaagaacctgggctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi autoantigen, golgin subfamily a, 2
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
- zinc finger and BTB domain containing 16
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 31

Buy CHRNA3-cholinergic receptor, nicotinic, alpha 3 Gene now

Add to cart