SPINK1-serine peptidase inhibitor, Kazal type 1 Gene View larger

SPINK1-serine peptidase inhibitor, Kazal type 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPINK1-serine peptidase inhibitor, Kazal type 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPINK1-serine peptidase inhibitor, Kazal type 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025790
Product type: DNA & cDNA
Ncbi symbol: SPINK1
Origin species: Human
Product name: SPINK1-serine peptidase inhibitor, Kazal type 1 Gene
Size: 2ug
Accessions: BC025790
Gene id: 6690
Gene description: serine peptidase inhibitor, Kazal type 1
Synonyms: PCTT; PSTI; Spink3; TATI; TCP; serine protease inhibitor Kazal-type 1; pancreatic secretory trypsin inhibitor; serine protease inhibitor, Kazal type 1; tumor-associated trypsin inhibitor; serine peptidase inhibitor, Kazal type 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggtaacaggcatctttcttctcagtgccttggccctgttgagtctatctggtaacactggagctgactccctgggaagagaggccaaatgttacaatgaacttaatggatgcaccaagatatatgaccctgtctgtgggactgatggaaatacttatcccaatgaatgcgtgttatgttttgaaaatcggaaacgccagacttctatcctcattcaaaaatctgggccttgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat domain 1 (cardiac muscle)
- glycerol-3-phosphate dehydrogenase 1-like
- zinc finger and BTB domain containing 37
- cholinergic receptor, nicotinic, alpha 3

Buy SPINK1-serine peptidase inhibitor, Kazal type 1 Gene now

Add to cart