ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene View larger

ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018667
Product type: DNA & cDNA
Ncbi symbol: ANKRD1
Origin species: Human
Product name: ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene
Size: 2ug
Accessions: BC018667
Gene id: 27063
Gene description: ankyrin repeat domain 1 (cardiac muscle)
Synonyms: ALRP; C-193; CARP; CVARP; MCARP; bA320F15.2; ankyrin repeat domain-containing protein 1; ankyrin repeat domain 1 (cardiac muscle); cardiac ankyrin repeat protein; cytokine-inducible gene C-193 protein; cytokine-inducible nuclear protein; liver ankyrin repeat domain 1; ankyrin repeat domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggtactgaaagtagaggaactggtcactggaaagaagaatggcaatggggaggcaggggaattccttcctgaggatttcagagatggagagtatgaagctgctgttactttagagaagcaggaggatctgaagacacttctagcccaccctgtgaccctgggggagcaacagtggaaaagcgagaaacaacgagaggcagagctcaaaaagaaaaaactagaacaaagatcaaagcttgaaaatttagaagaccttgaaataatcattcaactgaagaaaaggaaaaaatacaggaaaactaaagttccagttgtaaaggaaccagaacctgaaatcattacggaacctgtggatgtgcctacgtttctgaaggctgctctggagaataaactgccagtagtagaaaaattcttgtcagacaagaacaatccagatgtttgtgatgagtataaacggacagctcttcatagagcatgcttggaaggacatttggcaattgtggagaagttaatggaagctggagcccagatcgaattccgtgatatgcttgaatccacagccatccactgggcaagccgtggaggaaacctggatgttttaaaattgttgctgaataaaggagcaaaaattagcgcccgagataagttgctcagcacagcgctgcatgtggcggtgaggactggccactatgagtgcgcggagcatcttatcgcctgtgaggcagacctcaacgccaaagacagagaaggagataccccgttgcatgatgcggtgagactgaaccgctataagatgatccgactcctgattatgtatggcgcggatctcaacatcaagaactgtgctgggaagacgccgatggatctggtgctacactggcagaatggaaccaaagcaatattcgacagcctcagagagaactcctacaagacctctcgcatagctacattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycerol-3-phosphate dehydrogenase 1-like
- zinc finger and BTB domain containing 37
- cholinergic receptor, nicotinic, alpha 3
- golgi autoantigen, golgin subfamily a, 2

Buy ANKRD1-ankyrin repeat domain 1 (cardiac muscle) Gene now

Add to cart