EIF6-eukaryotic translation initiation factor 6 Gene View larger

EIF6-eukaryotic translation initiation factor 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF6-eukaryotic translation initiation factor 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF6-eukaryotic translation initiation factor 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001119
Product type: DNA & cDNA
Ncbi symbol: EIF6
Origin species: Human
Product name: EIF6-eukaryotic translation initiation factor 6 Gene
Size: 2ug
Accessions: BC001119
Gene id: 3692
Gene description: eukaryotic translation initiation factor 6
Synonyms: CAB; EIF3A; ITGB4BP; b(2)gcn; eIF-6; p27(BBP); p27BBP; eukaryotic translation initiation factor 6; B4 integrin interactor; eukaryotic translation initiation factor 3A; p27 beta-4 integrin-binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtccgagcttcgttcgagaacaactgtgagatcggctgctttgccaagctcaccaacacctactgtctggtagcgatcggaggctcagagaacttctacagtgtgttcgagggcgagctctccgataccatccccgtggtgcacgcgtctatcgccggctgccgcatcatcgggcgcatgtgtgtggggaacaggcacggtctcctggtacccaacaataccaccgaccaggagctgcaacacattcgcaacagcctcccagacacagtgcagattaggcgggtggaggagcggctctcagccttgggcaatgtcaccacctgcaatgactacgtggccttggtccacccagacttggacagggagacagaagaaattctggcagatgtgctcaaggtggaagtcttcagacagacagtggccgaccaggtgctagtaggaagctactgtgtcttcagcaatcagggagggctggtgcatcccaagacttcaattgaagaccaggatgagctgtcctctcttcttcaagtcccccttgtggcggggactgtgaaccgaggcagtgaggtgattgctgctgggatggtggtgaatgactggtgtgccttctgtggcctggacacaaccagcacagagctgtcagtggtggagagtgtcttcaagctgaatgaagcccagcctagcaccattgccaccagcatgcgggattccctcattgacagcctcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FGGY carbohydrate kinase domain containing
- serine peptidase inhibitor, Kazal type 1
- ankyrin repeat domain 1 (cardiac muscle)
- glycerol-3-phosphate dehydrogenase 1-like

Buy EIF6-eukaryotic translation initiation factor 6 Gene now

Add to cart