FUBP3-far upstream element (FUSE) binding protein 3 Gene View larger

FUBP3-far upstream element (FUSE) binding protein 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUBP3-far upstream element (FUSE) binding protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FUBP3-far upstream element (FUSE) binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007874
Product type: DNA & cDNA
Ncbi symbol: FUBP3
Origin species: Human
Product name: FUBP3-far upstream element (FUSE) binding protein 3 Gene
Size: 2ug
Accessions: BC007874
Gene id: 8939
Gene description: far upstream element (FUSE) binding protein 3
Synonyms: FBP3; far upstream element-binding protein 3; FUSE-binding protein 3; far upstream element (FUSE) binding protein 3; far upstream element binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcctataggtaaccagttaggggccttggtacatcaaaggacggtaataacggaagaattcaaagtgcctgacaaaatggttggatttattatcggcaggggaggtgagcagatttcacggattcaagcagaatctggttgcaaaattcagattgcttcagagagttctgggattccagagaggccctgtgtacttaccggaaccccagaaagtattgaacaagccaaacggctcctgggacagattgtggaccgctgtcgaaatggacctggctttcataatgacatagacagcaacagcacaatccaggagattctcattcccgcatctaaagtgggtctggtcatcggcagaggaggggaaacaatcaagcagttgcaggagcggacaggggtgaagatggtcatgatccaggatggcccattgcccacgggagcagacaagcctcttcgtatcactggagatgcatttaaagtacagcaagcaagagaaatggtactagagattatccgagaaaaagaccaagctgactttcggggtgtacgcggcgatttcaactctcgaatgggaggaggcagtatagaggtatctgtgcctaggtttgctgtggggattgtaataggaagaaacggggaaatgatcaaaaagatccagaatgatgctggtgtgaggattcagtttaaaccagatgatgggattagtccagaatattacagacagcaggtcgctttctacggacagacgttagggcaggcgcaggcccacagccaggagcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA selenocysteine 1 associated protein 1
- family with sequence similarity 49, member B
- purinergic receptor P2Y, G-protein coupled, 2
- tubulin tyrosine ligase-like family, member 1

Buy FUBP3-far upstream element (FUSE) binding protein 3 Gene now

Add to cart