Login to display prices
Login to display prices
FUBP3-far upstream element (FUSE) binding protein 3 Gene View larger

FUBP3-far upstream element (FUSE) binding protein 3 Gene

PTXBC007874

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUBP3-far upstream element (FUSE) binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUBP3-far upstream element (FUSE) binding protein 3 Gene

Proteogenix catalog: PTXBC007874
Ncbi symbol: FUBP3
Product name: FUBP3-far upstream element (FUSE) binding protein 3 Gene
Size: 2ug
Accessions: BC007874
Gene id: 8939
Gene description: far upstream element (FUSE) binding protein 3
Synonyms: FBP3; far upstream element-binding protein 3; FUSE-binding protein 3; far upstream element (FUSE) binding protein 3; far upstream element binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcctataggtaaccagttaggggccttggtacatcaaaggacggtaataacggaagaattcaaagtgcctgacaaaatggttggatttattatcggcaggggaggtgagcagatttcacggattcaagcagaatctggttgcaaaattcagattgcttcagagagttctgggattccagagaggccctgtgtacttaccggaaccccagaaagtattgaacaagccaaacggctcctgggacagattgtggaccgctgtcgaaatggacctggctttcataatgacatagacagcaacagcacaatccaggagattctcattcccgcatctaaagtgggtctggtcatcggcagaggaggggaaacaatcaagcagttgcaggagcggacaggggtgaagatggtcatgatccaggatggcccattgcccacgggagcagacaagcctcttcgtatcactggagatgcatttaaagtacagcaagcaagagaaatggtactagagattatccgagaaaaagaccaagctgactttcggggtgtacgcggcgatttcaactctcgaatgggaggaggcagtatagaggtatctgtgcctaggtttgctgtggggattgtaataggaagaaacggggaaatgatcaaaaagatccagaatgatgctggtgtgaggattcagtttaaaccagatgatgggattagtccagaatattacagacagcaggtcgctttctacggacagacgttagggcaggcgcaggcccacagccaggagcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: