TTLL1-tubulin tyrosine ligase-like family, member 1 Gene View larger

TTLL1-tubulin tyrosine ligase-like family, member 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTLL1-tubulin tyrosine ligase-like family, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TTLL1-tubulin tyrosine ligase-like family, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014968
Product type: DNA & cDNA
Ncbi symbol: TTLL1
Origin species: Human
Product name: TTLL1-tubulin tyrosine ligase-like family, member 1 Gene
Size: 2ug
Accessions: BC014968
Gene id: 25809
Gene description: tubulin tyrosine ligase-like family, member 1
Synonyms: C22orf7; HS323M22B; PGs3; catalytic subunit of neural tubulin polyglutamylase; tubulin polyglutamylase complex subunit 3; tubulin tyrosine ligase-like family, member 1; tubulin--tyrosine ligase-like protein 1; tubulin-tyrosine ligase; tubulin tyrosine ligase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagggaaagtaaaatgggtcactgatatcgagaagtcagtgctgatcaataactttgaaaagagaggatgggtccaagtgacagaaaacgaggactggaatttttactggatgagtgtgcaaaccatccgaaatgtgttcagcgttgaagctggatatcggctctcagatgaccaaatagtcaaccattttccaaaccactatgaactgacccggaaggacctgatggtgaagaacatcaaaagatacaggaaggagctggagaaagaagggagtcctctggcagaaaaagatgaaaatggaaaatacctctatctggactttgttccagtcacctatatgctgcccgctgactacaacctgtttgtagaggagttccggaagagcccgtccagcacctggatcatgaagccttgtggcaaggcccagggaaagggcatcttccttatcaacaagctctcacagatcaaaaagtggtcccgggacagcaagacatcttcgtttgtgtctcaatctaataaggaagcctacgtgatctctctctatattaacaacccgttactaattggcgggaggaagttcgacctgcgcttgtacgttctggtgtccacgtaccgtccactgcgctgttacatgtacaagcttgggttttgccggttctgcacagtgaaatacaccccgagtaccagtgagctggacaacatgttcgttcatctcaccaacgtcgccatccagaaacacggggaggactacaaccacatccatgggggcaagtggacagtgagtaacctgcggctctacctggagagcacccgcggcaaggaggtgaccagcaagctgttcgacgagatccactggatcatcgtgcagtccctgaaggctgtggcgccggtgatgaacaatgacaagcactgctttgaatgctatggctacgacatcatcatcgacgacaagctgaagccctggctgatcgaggtgaatgcgtccccgtctctcacgtccagcactgccaatgaccgaatcctcaagtacaacctgattaatgacaccctcaacatcgccgtcccgaatggtgaaatcccagactgcaaatggaacaagtcgccacctaaggaagtcctcggcaattacgagattctgtatgatgaagaattggcccagggtgacggggctgaccgggagctgagaagccgtcagggtcagtctctggggcccagagcaggccgatcgagagactcggggagagcggtcctcaccacctggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - minichromosome maintenance complex component 6
- gamma-aminobutyric acid (GABA) B receptor, 2
- ATPase, Ca++ transporting, type 2C, member 1
- minichromosome maintenance complex component 2

Buy TTLL1-tubulin tyrosine ligase-like family, member 1 Gene now

Add to cart