Login to display prices
Login to display prices
P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene View larger

P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene

PTXBC012104

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene

Proteogenix catalog: PTXBC012104
Ncbi symbol: P2RY2
Product name: P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene
Size: 2ug
Accessions: BC012104
Gene id: 5029
Gene description: purinergic receptor P2Y, G-protein coupled, 2
Synonyms: HP2U; P2RU1; P2U; P2U1; P2UR; P2Y2; P2Y2R; P2Y purinoceptor 2; ATP receptor; P2U nucleotide receptor; P2U purinoceptor 1; P2U receptor 1; purinergic receptor P2Y, G-protein coupled, 2; purinoceptor P2Y2; purinergic receptor P2Y2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttcttgtgccgcctcaagacctggaatgcgtccaccacatatatgttccacctggctgtgtctgatgcactgtatgcggcctccctgccgctgctggtctattactacgcccgcggcgaccactggcccttcagcacggtgctctgcaagctggtgcgcttcctcttctacaccaacctttactgcagcatcctcttcctcacctgcatcagcgtgcaccggtgtctgggcgtcttacgacctctgcgctccctgcgctggggccgggcccgctacgctcgccgggtggccggggccgtgtgggtgttggtgctggcctgccaggcccccgtgctctactttgtcaccaccagcgcgcgcgggggccgcgtaacctgccacgacacctcggcacccgagctcttcagccgcttcgtggcctacagctcagtcatgctgggcctgctcttcgcggtgccctttgccgtcatccttgtctgttacgtgctcatggctcggcgactgctaaagccagcctacgggacctcgggcggcctgcctagggccaagcgcaagtccgtgcgcaccatcgccgtggtgctggctgtcttcgccctctgcttcctgccattccacgtcacccgcaccctctactactccttccgttcgctggacctcagctgccacaccctcaacgccatcaacatggcctacaaggttacccggccgctggccagtgctaacagttgccttgaccccgtgctctacttcctggctgggcagagcctcgtacgctttgcccgagatgccaagccacccactggccccagccctgccaccccggctcgccgcaggctgggcctgcgcagatccgacagaactgacatgcagaggatagaagatgtgttgggcagcagtgaggactctaggcggacagagtccacgccggctggtagcgagaacactaaggacattcggctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: