Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012104 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RY2 |
| Origin species: | Human |
| Product name: | P2RY2-purinergic receptor P2Y, G-protein coupled, 2 Gene |
| Size: | 2ug |
| Accessions: | BC012104 |
| Gene id: | 5029 |
| Gene description: | purinergic receptor P2Y, G-protein coupled, 2 |
| Synonyms: | HP2U; P2RU1; P2U; P2U1; P2UR; P2Y2; P2Y2R; P2Y purinoceptor 2; ATP receptor; P2U nucleotide receptor; P2U purinoceptor 1; P2U receptor 1; purinergic receptor P2Y, G-protein coupled, 2; purinoceptor P2Y2; purinergic receptor P2Y2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttcttgtgccgcctcaagacctggaatgcgtccaccacatatatgttccacctggctgtgtctgatgcactgtatgcggcctccctgccgctgctggtctattactacgcccgcggcgaccactggcccttcagcacggtgctctgcaagctggtgcgcttcctcttctacaccaacctttactgcagcatcctcttcctcacctgcatcagcgtgcaccggtgtctgggcgtcttacgacctctgcgctccctgcgctggggccgggcccgctacgctcgccgggtggccggggccgtgtgggtgttggtgctggcctgccaggcccccgtgctctactttgtcaccaccagcgcgcgcgggggccgcgtaacctgccacgacacctcggcacccgagctcttcagccgcttcgtggcctacagctcagtcatgctgggcctgctcttcgcggtgccctttgccgtcatccttgtctgttacgtgctcatggctcggcgactgctaaagccagcctacgggacctcgggcggcctgcctagggccaagcgcaagtccgtgcgcaccatcgccgtggtgctggctgtcttcgccctctgcttcctgccattccacgtcacccgcaccctctactactccttccgttcgctggacctcagctgccacaccctcaacgccatcaacatggcctacaaggttacccggccgctggccagtgctaacagttgccttgaccccgtgctctacttcctggctgggcagagcctcgtacgctttgcccgagatgccaagccacccactggccccagccctgccaccccggctcgccgcaggctgggcctgcgcagatccgacagaactgacatgcagaggatagaagatgtgttgggcagcagtgaggactctaggcggacagagtccacgccggctggtagcgagaacactaaggacattcggctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin tyrosine ligase-like family, member 1 - minichromosome maintenance complex component 6 - gamma-aminobutyric acid (GABA) B receptor, 2 - ATPase, Ca++ transporting, type 2C, member 1 |