Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene
PTXBC058286
New product
Data sheet of TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRPM1 |
| Origin species: | Human |
| Product name: | TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC058286 |
| Gene id: | 4308 |
| Gene description: | transient receptor potential cation channel, subfamily M, member 1 |
| Synonyms: | CSNB1C; LTRPC1; MLSN1; transient receptor potential cation channel subfamily M member 1; long transient receptor potential channel 1; melastatin-1; transient receptor potential melastatin family |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagactctaacaggtgttgctgtggccagttcaccaaccagcatatcccccctctgccaagtgcaacacccagcaaaaatgaagaggaaaacaaacaggtggagactcagcctgagaaatggtctgttgccaagcacacccagagctacccaacagattcctatggagttcttgaattccagggtggcggatattccaataaagccatggtgagaaaggcattcagacatggtgccactaggatcacagctttcattggcggccagtctcccagccccaaactgcagatacctggtcttcttcatggctgtggctcaatcttcctagatatttcattgaaaaaccaagagatatatctgtgcacatggcttttagccatgaggcttggaaactggacaccactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G - PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) |