TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene View larger

TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

PTXBC058286

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC058286
Product type: DNA & cDNA
Ncbi symbol: TRPM1
Origin species: Human
Product name: TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene
Size: 2ug
Accessions: BC058286
Gene id: 4308
Gene description: transient receptor potential cation channel, subfamily M, member 1
Synonyms: CSNB1C; LTRPC1; MLSN1; transient receptor potential cation channel subfamily M member 1; long transient receptor potential channel 1; melastatin-1; transient receptor potential melastatin family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagactctaacaggtgttgctgtggccagttcaccaaccagcatatcccccctctgccaagtgcaacacccagcaaaaatgaagaggaaaacaaacaggtggagactcagcctgagaaatggtctgttgccaagcacacccagagctacccaacagattcctatggagttcttgaattccagggtggcggatattccaataaagccatggtgagaaaggcattcagacatggtgccactaggatcacagctttcattggcggccagtctcccagccccaaactgcagatacctggtcttcttcatggctgtggctcaatcttcctagatatttcattgaaaaaccaagagatatatctgtgcacatggcttttagccatgaggcttggaaactggacaccactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
- PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
- methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
- PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)

Buy TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene now

Add to cart