Login to display prices
Login to display prices
TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene View larger

TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

PTXBC058286

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene

Proteogenix catalog: PTXBC058286
Ncbi symbol: TRPM1
Product name: TRPM1-transient receptor potential cation channel, subfamily M, member 1 Gene
Size: 2ug
Accessions: BC058286
Gene id: 4308
Gene description: transient receptor potential cation channel, subfamily M, member 1
Synonyms: CSNB1C; LTRPC1; MLSN1; transient receptor potential cation channel subfamily M member 1; long transient receptor potential channel 1; melastatin-1; transient receptor potential melastatin family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagactctaacaggtgttgctgtggccagttcaccaaccagcatatcccccctctgccaagtgcaacacccagcaaaaatgaagaggaaaacaaacaggtggagactcagcctgagaaatggtctgttgccaagcacacccagagctacccaacagattcctatggagttcttgaattccagggtggcggatattccaataaagccatggtgagaaaggcattcagacatggtgccactaggatcacagctttcattggcggccagtctcccagccccaaactgcagatacctggtcttcttcatggctgtggctcaatcttcctagatatttcattgaaaaaccaagagatatatctgtgcacatggcttttagccatgaggcttggaaactggacaccactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: