No products
Prices are tax excluded
PTXBC070274
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC070274 |
Product type: | DNA & cDNA |
Ncbi symbol: | PDS5B |
Origin species: | Human |
Product name: | PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC070274 |
Gene id: | 23047 |
Gene description: | PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) |
Synonyms: | APRIN; AS3; CG008; sister chromatid cohesion protein PDS5 homolog B; androgen induced inhibitor of proliferation; androgen-induced proliferation inhibitor; androgen-induced prostate proliferative shutoff-associated protein AS3; androgen-induced shutoff 3; PDS5 cohesin associated factor B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacctagctttacatcttgcttcagatttttttctcaagcatcctgataaagatgttcgcttactggtagcctgctgccttgctgatattttcaggatttatgctcctgaagctccttacacatcccctgataaactaaaggcaagtactgatttaaataactccaagattgaccgatactttgatttatctttctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) - N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase - Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 |