Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene
PTXBC070274
New product
Data sheet of PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070274 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDS5B |
| Origin species: | Human |
| Product name: | PDS5B-PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC070274 |
| Gene id: | 23047 |
| Gene description: | PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) |
| Synonyms: | APRIN; AS3; CG008; sister chromatid cohesion protein PDS5 homolog B; androgen induced inhibitor of proliferation; androgen-induced proliferation inhibitor; androgen-induced prostate proliferative shutoff-associated protein AS3; androgen-induced shutoff 3; PDS5 cohesin associated factor B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacctagctttacatcttgcttcagatttttttctcaagcatcctgataaagatgttcgcttactggtagcctgctgccttgctgatattttcaggatttatgctcctgaagctccttacacatcccctgataaactaaaggcaagtactgatttaaataactccaagattgaccgatactttgatttatctttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) - N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase - Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 |