Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RASSF9-Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 Gene
PTXBC031589
New product
Data sheet of RASSF9-Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RASSF9-Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031589 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RASSF9 |
| Origin species: | Human |
| Product name: | RASSF9-Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 Gene |
| Size: | 2ug |
| Accessions: | BC031589 |
| Gene id: | 9182 |
| Gene description: | Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 |
| Synonyms: | P-CIP1; PAMCI; PCIP1; ras association domain-containing protein 9; PAM COOH-terminal interactor protein 1; Ras association (RalGDS/AF-6) domain family (N-terminal) member 9; peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor protein-1; Ras association domain family member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctccctttggaagaaacttgctaaagactcggcataaaaacagatctccaactaaagacatggattcagaagagaaggaaattgtggtttgggtttgccaagaagagaagcttgtctgtgggctgactaaacgcaccacctctgctgatgtcatccaggctttgcttgaggaacatgaggctacgtttggagagaaacgatttcttctggggaagcccagtgattactgcatcatagagaagtggagaggctccgaaagggttcttcctccactaactagaatcctgaagctttggaaagcgtggggagatgagcagcccaatatgcaatttgttttggttaaagcagatgcttttcttccagttcctttgtggcggacagctgaagccaaattagtgcaaaacacagaaaaattgtgggagctcagcccagcaaactacatgaagactttaccaccagataaacaaaaaagaatagtcaggaaaactttccggaaactggctaaaattaagcaggacacagtttctcatgatcgagataatatggagacattagttcatctgatcatttcccaggaccatactattcatcagcaagtcaagagaatgaaagagctggatctggaaattgaaaagtgtgaagctaagttccatcttgatcgagtagaaaatgatggagaaaactatgttcaggatgcatatttaatgcccagtttcagtgaagttgagcaaaatctagacttgcagtatgaggaaaaccagactctggaggacctgagcgaaagtgatggaattgaacagctggaagaacgactgaaatattaccgaatactcattgataagctctctgctgaaatagaaaaagaggtaaaaagtgtttgcattgatataaatgaagatgcggaaggggaagctgcaagtgaactggaaagctctaatttagagagtgttaagtgtgatttggagaaaagcatgaaagctggtttgaaaattcactctcatttgagtggcatccagaaagagattaaatacagtgactcattgcttcagatgaaagcaaaagaatatgaactcctggccaaggaattcaattcacttcacattagcaacaaagatgggtgccagttaaaggaaaacagagcgaaggaatctgaggttcccagtagcaatggggagattcctccctttactcaaagagtatttagcaattacacaaatgacacagactcggacactggtatcagttctaaccacagtcaggactccgaaacaacagtaggagatgtggtgctgttgtcaacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transient receptor potential cation channel, subfamily V, member 4 - minichromosome maintenance complex component 3 associated protein - transient receptor potential cation channel, subfamily C, member 4 - transient receptor potential cation channel, subfamily M, member 8 |