Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene
PTXBC070165
New product
Data sheet of ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070165 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5L |
| Origin species: | Human |
| Product name: | ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene |
| Size: | 2ug |
| Accessions: | BC070165 |
| Gene id: | 10632 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G |
| Synonyms: | ATP5JG; ATP synthase subunit g, mitochondrial; ATP synthase g chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G; ATP synthase, H+ transporting, mitochondrial F1F0, subunit g; ATPase subunit G; F1F0-type ATP synthase subunit g; F1Fo-ATP synthase complex Fo membrane domain g subunit; ATP synthase, H+ transporting, mitochondrial Fo complex subunit G |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccaatttgtccgtaaccttgtggagaagaccccggcgctggtgaacgctgctgtgacttactcgaagcctcgattggccacattttggtactacgccaaggttgagctggttcctcccacccctgctgagatccctagagctattcagagcctgaaaaaaatagtcaatagtgctcagactggtagcttcaaacagctcacagttaaggaagctgtgctgaatggtttggtggccactgaggtgttgatgtggttttatgtcggagagattataggcaagcggggcatcattggctatgatgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) - N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase |