CXXC5-CXXC finger 5 Gene View larger

CXXC5-CXXC finger 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXXC5-CXXC finger 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXXC5-CXXC finger 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006428
Product type: DNA & cDNA
Ncbi symbol: CXXC5
Origin species: Human
Product name: CXXC5-CXXC finger 5 Gene
Size: 2ug
Accessions: BC006428
Gene id: 51523
Gene description: CXXC finger 5
Synonyms: CF5; HSPC195; RINF; WID; CXXC-type zinc finger protein 5; CXXC finger 5 protein; WT1-induced Inhibitor of Dishevelled; retinoid-inducible nuclear factor; CXXC finger protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggcggagagtctgctgacaaggccactgcggctgcagccgctgcctccctgttggccaatgggcatgacctggcggcggccatggcggtggacaaaagcaaccctacctcaaagcacaaaagtggtgctgtggccagcctgctgagcaaggcagagcgggccacggagctggcagccgagggacagctgacgctgcagcagtttgcgcagtccacagagatgctgaagcgcgtggtgcaggagcatctcccgctgatgagcgaggcgggtgctggcctgcctgacatggaggctgtggcaggtgccgaagccctcaatggccagtccgacttcccctacctgggcgctttccccatcaacccaggcctcttcattatgaccccggcaggtgtgttcctggccgagagcgcgctgcacatggcgggcctggctgagtaccccatgcagggagagctggcctctgccatcagctccggcaagaagaagcggaaacgctgcggcatgtgcgcgccctgccggcggcgcatcaactgcgagcagtgcagcagttgtaggaatcgaaagactggccatcagatttgcaaattcagaaaatgtgaggaactcaaaaagaagccttccgctgctctggagaaggtgatgcttccgacgggagccgccttccggtggtttcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mohawk homeobox
- astrotactin 2
- THO complex 1
- G antigen 2E

Buy CXXC5-CXXC finger 5 Gene now

Add to cart