ASTN2-astrotactin 2 Gene View larger

ASTN2-astrotactin 2 Gene

PTXBC029272

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASTN2-astrotactin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASTN2-astrotactin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029272
Product type: DNA & cDNA
Ncbi symbol: ASTN2
Origin species: Human
Product name: ASTN2-astrotactin 2 Gene
Size: 2ug
Accessions: BC029272
Gene id: 23245
Gene description: astrotactin 2
Synonyms: bA67K19.1; astrotactin-2; bA264C15.1; astrotactin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacacattgctctgtaaaggaatgttttgcctactcagctgggaggccgacagcagaggcagacttggggagtacactctgcagcccctgtccctgcagactgaagagaccacagagctgggcagcaagaaggagctcaagtccatgcccttcatcacctacctctcaggtttgctgacagcccagatgctgtcagatgaccagctcatttcaggtgtggagattcgctgtgaggagaaggggcgctgtccatctacctgtcacctttgccgccggccaggcaaggagcagctgagccccacaccagtgctgctggaaatcaaccgtgtggtgccactttataccctcatccaagacaatggcacaaaggaggccttcaagagtgcactgatgagttcctactggtgctcagggaaaggggatgtgatcgatgactggtgcaggtgtgacctcagcgcctttgatgccaatgggctccccaactgcagcccccttctgcagccggtgctgcggctgtccccaacagtggagccctccagtactgtggtctccttggagtgggtggatgttcagccagctattgggaccaaggtctccgactatattctgcagcataagaaagtggatgaatacacagacactgacctgtacacaggagaattcctgagttttgctgatgacttactctctggcctgggcacatcttgtgtagcagctggtcgaagccatggagaggtccctgaagtcagtatctactcagtcatcttcaagtgtctggagcccgacggtctctacaagttcactctgtatgctgtggatacacgagggaggcactcagagctaagcacggtgaccctgaggacggcctgtccactggtagatgacaacaaggcagaagaaatagctgacaagatctacaatctgtacaatgggtacacaagtggaaaggagcagcagatggcctacaacacactgatggaggtctcagcctcgatgctgttccgagtccagcaccactacaactctcactatgaaaagtttggcgacttcgtctggagaagtgaggatgagctggggcccaggaaggcccacctgattctacggcgactggagagggtgagtagccactgctccagcctcctgcggagtgcctacatccagagccgcgtggaaacagtgccctatcttttctgccgcagcgaggaggtccggcctgcaggcatggtgtggtatagcatcctcaaggacaccaaaatcatgtgtgaggagaagatggtgtcaatggcccgaaacacgtacggggagtccaagggccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THO complex 1
- G antigen 2E
- cyclin J-like
- dCMP deaminase

Buy ASTN2-astrotactin 2 Gene now

Add to cart