Login to display prices
Login to display prices
GAGE2E-G antigen 2E Gene View larger

GAGE2E-G antigen 2E Gene

PTXBC018052

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAGE2E-G antigen 2E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GAGE2E-G antigen 2E Gene

Proteogenix catalog: PTXBC018052
Ncbi symbol: GAGE2E
Product name: GAGE2E-G antigen 2E Gene
Size: 2ug
Accessions: BC018052
Gene id: 26749
Gene description: G antigen 2E
Synonyms: GAGE-2E; GAGE8; G antigen 2E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggcgaggaagatcgacctatcggcctagaccaagacgctacgtagagcctcctgaaatgattgggcctatgcggcccgagcagttcagtgatgaagtggaaccagcaacacctgaagaaggggaaccagcaactcaacgtcaggatcctgcagctgctcaggagggagaggatgagggagcatctgcaggtcaagggccgaagcctgaagctgatagccaggaacagggtcacccacagactgggtgtgagtgtgaagatggtcctgatgggcaggagatggacccgccaaatccagaggaggtgaaaacgcctgaagaaggtgaaaagcaatcacagtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: