GAGE2E-G antigen 2E Gene View larger

GAGE2E-G antigen 2E Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAGE2E-G antigen 2E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GAGE2E-G antigen 2E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018052
Product type: DNA & cDNA
Ncbi symbol: GAGE2E
Origin species: Human
Product name: GAGE2E-G antigen 2E Gene
Size: 2ug
Accessions: BC018052
Gene id: 26749
Gene description: G antigen 2E
Synonyms: GAGE-2E; GAGE8; G antigen 2E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggcgaggaagatcgacctatcggcctagaccaagacgctacgtagagcctcctgaaatgattgggcctatgcggcccgagcagttcagtgatgaagtggaaccagcaacacctgaagaaggggaaccagcaactcaacgtcaggatcctgcagctgctcaggagggagaggatgagggagcatctgcaggtcaagggccgaagcctgaagctgatagccaggaacagggtcacccacagactgggtgtgagtgtgaagatggtcctgatgggcaggagatggacccgccaaatccagaggaggtgaaaacgcctgaagaaggtgaaaagcaatcacagtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin J-like
- dCMP deaminase
- transgelin 3
- latrophilin 1

Buy GAGE2E-G antigen 2E Gene now

Add to cart