LPHN1-latrophilin 1 Gene View larger

LPHN1-latrophilin 1 Gene

PTXBC019928

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LPHN1-latrophilin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LPHN1-latrophilin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019928
Product type: DNA & cDNA
Ncbi symbol: LPHN1
Origin species: Human
Product name: LPHN1-latrophilin 1 Gene
Size: 2ug
Accessions: BC019928
Gene id: 22859
Gene description: latrophilin 1
Synonyms: LPHN1; CIRL1; CL1; LEC2; adhesion G protein-coupled receptor L1; CIRL-1; calcium-independent alpha-latrotoxin receptor 1; latrophilin-1; lectomedin-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctgatttcccacctagagaggttgatggcagaaggaaaatggggaggcactggggttgtggagggcatgggtatggctgaggagggtgctgggaacggcaaggcggtctgggggatggggaggggcaaaggtgagagatcaccttccctatcctccaccttcccgcagggaagacgaagccaggtgccagggctggggtcgggacacccatgttctgggcggcttgaccccaaatcccagaccccggaagctccaggctcgggatgtgtcctgagcacctgtcccggccccctcctctccagcctgtcaggccagcctccccagcccccttccctcaactctaggggcagcatagccccaggccaccctagcccagcccctgcattgccgtttccccagaggtggcccctccacctctgctctgacctctccccatctctctgcccctccttttctcacaagtgccatgagttttcaaacatcttcgggtctcagcctgctgctgccatgaactttgttgggttaagggggaggggctctaggaaggaactggggggaaggggacaggtaggtggctggagggaccctttttgctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 24
- interleukin 32
- SIX homeobox 1
- phosducin-like

Buy LPHN1-latrophilin 1 Gene now

Add to cart