Login to display prices
Login to display prices
SIX1-SIX homeobox 1 Gene View larger

SIX1-SIX homeobox 1 Gene

PTXBC008874

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIX1-SIX homeobox 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SIX1-SIX homeobox 1 Gene

Proteogenix catalog: PTXBC008874
Ncbi symbol: SIX1
Product name: SIX1-SIX homeobox 1 Gene
Size: 2ug
Accessions: BC008874
Gene id: 6495
Gene description: SIX homeobox 1
Synonyms: homeobox protein SIX1; BOS3; DFNA23; TIP39; sine oculis homeobox homolog 1; SIX homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgatgctgccgtcgtttggctttacgcaggagcaagtggcgtgcgtgtgcgaggttctgcagcaaggcggaaacctggagcgcctgggcaggttcctgtggtcactgcccgcctgcgaccacctgcacaagaacgagagcgtactcaaggccaaggcggtggtcgccttccaccgcggcaacttccgtgagctctacaagatcctggagagccaccagttctcgcctcacaaccaccccaaactgcagcaactgtggctgaaggcgcattacgtggaggccgagaagctgtgcggccgacccctgggcgccgtgggcaaatatcgggtgcgccgaaaatttccactgccgcgcaccatctgggacggcgaggagaccagctactgcttcaaggagaagtcgaggggtgtcctgcgggagtggtacgcgcacaatccctacccatcgccgcgtgagaagcgggagctggccgaggccaccggcctcaccaccacccaggtcagcaactggtttaagaaccggaggcaaagagaccgggccgcggaggccaaggaaagggagaacaccgaaaacaataactcctcctccaacaagcagaaccaactctctcctctggaagggggcaagccgctcatgtccagctcagaagaggaattctcacctccccaaagtccagaccagaactcggtccttctgctgcagggcaatatgggccacgccaggagctcaaactattctctcccgggcttaacagcctcgcagcccagtcacggcctgcagacccaccagcatcagctccaagactctctgctcggccccctcacctccagtctggtggacttggggtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: