HOXC11-homeobox C11 Gene View larger

HOXC11-homeobox C11 Gene

PTXBC001543

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HOXC11-homeobox C11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HOXC11-homeobox C11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001543
Product type: DNA & cDNA
Ncbi symbol: HOXC11
Origin species: Human
Product name: HOXC11-homeobox C11 Gene
Size: 2ug
Accessions: BC001543
Gene id: 3227
Gene description: homeobox C11
Synonyms: HOX3H; homeobox protein Hox-C11; homeo box C11; homeobox protein Hox-3H; homeobox C11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttaactcggtcaacctgggcaacttctgctcgccgtcgcgcaaggagaggggcgcagatttcggcgagcgagggagctgcgcctccaacctctatctgcccagttgcacttactacatgcccgagttctccacggtcttctccttcctgccccaggccccctctcgtcagatctcctatccctactcggcccaagtgcccccggtccgggaggtctcctacggcctggagccatccggcaagtggcaccatcggaacagctactcctcctgctatgcggcggccgacgagcttatgcaccgggagtgcctgcctccttccaccgtcaccgagatcctcatgaaaaacgaaggctcctacggcggccaccaccaccccagcgccccgcacgcaacccccgccggcttctactcctcagtcaacaagaacagcgtcctgcctcaagccttcgaccgtttcttcgacaacgcctactgcggtggcggcgacccgcccgccgagcccccctgctccggcaagggcgaggccaagggggagcccgaggcacccccggcctcgggactggcgtcccgggctgaggcgggtgccgaggcggaggctgaggaggagaacacaaatcccagctcgtccggttcagcccactccgtggccaaggagccggccaaaggagccgcccccaacgccccccgcacccgcaagaagcgctgcccttattcgaaattccagatccgggaactggagcgagagtttttcttcaacgtgtatatcaacaaagagaagcggctgcagctgtcccggatgctgaacctgacggaccgacaagtgaaaatttggtttcagaacagaaggatgaaagaaaagaaactgagcagagaccggctgcagtatttctcgggaaatcctctgctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pim-2 oncogene
- crystallin, mu
- homeobox C10
- THO complex 3

Buy HOXC11-homeobox C11 Gene now

Add to cart