Login to display prices
Login to display prices
HOXC11-homeobox C11 Gene View larger

HOXC11-homeobox C11 Gene

PTXBC001543

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HOXC11-homeobox C11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HOXC11-homeobox C11 Gene

Proteogenix catalog: PTXBC001543
Ncbi symbol: HOXC11
Product name: HOXC11-homeobox C11 Gene
Size: 2ug
Accessions: BC001543
Gene id: 3227
Gene description: homeobox C11
Synonyms: HOX3H; homeobox protein Hox-C11; homeo box C11; homeobox protein Hox-3H; homeobox C11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttaactcggtcaacctgggcaacttctgctcgccgtcgcgcaaggagaggggcgcagatttcggcgagcgagggagctgcgcctccaacctctatctgcccagttgcacttactacatgcccgagttctccacggtcttctccttcctgccccaggccccctctcgtcagatctcctatccctactcggcccaagtgcccccggtccgggaggtctcctacggcctggagccatccggcaagtggcaccatcggaacagctactcctcctgctatgcggcggccgacgagcttatgcaccgggagtgcctgcctccttccaccgtcaccgagatcctcatgaaaaacgaaggctcctacggcggccaccaccaccccagcgccccgcacgcaacccccgccggcttctactcctcagtcaacaagaacagcgtcctgcctcaagccttcgaccgtttcttcgacaacgcctactgcggtggcggcgacccgcccgccgagcccccctgctccggcaagggcgaggccaagggggagcccgaggcacccccggcctcgggactggcgtcccgggctgaggcgggtgccgaggcggaggctgaggaggagaacacaaatcccagctcgtccggttcagcccactccgtggccaaggagccggccaaaggagccgcccccaacgccccccgcacccgcaagaagcgctgcccttattcgaaattccagatccgggaactggagcgagagtttttcttcaacgtgtatatcaacaaagagaagcggctgcagctgtcccggatgctgaacctgacggaccgacaagtgaaaatttggtttcagaacagaaggatgaaagaaaagaaactgagcagagaccggctgcagtatttctcgggaaatcctctgctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: