CRYM-crystallin, mu Gene View larger

CRYM-crystallin, mu Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRYM-crystallin, mu Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRYM-crystallin, mu Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018061
Product type: DNA & cDNA
Ncbi symbol: CRYM
Origin species: Human
Product name: CRYM-crystallin, mu Gene
Size: 2ug
Accessions: BC018061
Gene id: 1428
Gene description: crystallin, mu
Synonyms: DFNA40; THBP; ketimine reductase mu-crystallin; NADP-regulated thyroid-hormone binding protein; mu-crystallin homolog; thiomorpholine-carboxylate dehydrogenase; crystallin mu
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccgggtaccagcgttcctgagcgcggccgaggtggaggaacacctccgcagctccagcctcctcatcccgcctctagagacggccctggccaacttctccagcggtcccgaaggaggggtcatgcagcccgtgcgcaccgtggtgccggtgaccaagcacaggggctacctgggggtcatgcccgcctacagtgctgcagaggatgcactgaccaccaagttggtcaccttctacgaggaccgcggcatcacctcggtcgtcccttcccaccaggctactgtgctactctttgagcccagcaatggcaccctgctggcggtcatggatggaaatgtcataactgcaaagagaacagctgcagtttctgccattgccaccaagtttctgaaacctcccagcagtgaagtgctgtgcatccttggggctggggtccaggcctacagccattatgagatcttcacagagcagttctcctttaaggaggtgaggatatggaaccgcaccaaagaaaatgcagagaagtttgcagacacagtgcaaggagaggtacgggtctgttcttcggtccaggaggctgtggcaggtgcagatgtgatcatcacagtcaccctggcaacagagcccattttgtttggtgaatgggtgaagccaggggctcacatcaatgctgttggagccagcagacctgactggagagaactggatgatgagctcatgaaagaagctgtgctgtacgtggattcccaggaggctgccctgaaggagtctggagatgtcctgctgtcaggggccgagatctttgctgagctgggagaagtgattaagggagtgaaaccagcccactgtgagaagaccacggtgttcaagtctttgggaatggcagtggaagacacagttgcagccaaactcatctatgattcctggtcatctggtaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - homeobox C10
- THO complex 3
- chondroadherin
- inhibin, alpha

Buy CRYM-crystallin, mu Gene now

Add to cart