PIM2-pim-2 oncogene Gene View larger

PIM2-pim-2 oncogene Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIM2-pim-2 oncogene Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIM2-pim-2 oncogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018111
Product type: DNA & cDNA
Ncbi symbol: PIM2
Origin species: Human
Product name: PIM2-pim-2 oncogene Gene
Size: 2ug
Accessions: BC018111
Gene id: 11040
Gene description: pim-2 oncogene
Synonyms: serine/threonine-protein kinase pim-2; pim-2 oncogene; pim-2h; proto-oncogene Pim-2 (serine threonine kinase); Pim-2 proto-oncogene, serine/threonine kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaccaagcctctacaggggcctcccgcgccccccgggacccccacgccgccgccaggaggcaaggatcgggaagcgttcgaggccgagtatcgactcggccccctcctgggtaaggggggctttggcaccgtcttcgcaggacaccgcctcacagatcgactccaggtggccatcaaagtgattccccggaatcgtgtgctgggctggtcccccttgtcagactcagtcacatgcccactcgaagtcgcactgctatggaaagtgggtgcaggtggtgggcaccctggcgtgatccgcctgcttgactggtttgagacacaggagggcttcatgctggtcctcgagcggcctttgcccgcccaggatctctttgactatatcacagagaagggcccactgggtgaaggcccaagccgctgcttctttggccaagtagtggcagccatccagcactgccattcccgtggagttgtccatcgtgacatcaaggatgagaacatcctgatagacctacgccgtggctgtgccaaactcattgattttggttctggtgccctgcttcatgatgaaccctacactgactttgatgggacaagggtgtacagccccccagagtggatctctcgacaccagtaccatgcactcccggccactgtctggtcactgggcatcctcctctatgacatggtgtgtggggacattccctttgagagggaccaggagattctggaagctgagctccacttcccagcccatgtctccccagactgctgtgccctaatccgccggtgcctggcccccaaaccttcttcccgaccctcactggaagagatcctgctggacccctggatgcaaacaccagccgaggatgtacccctcaacccctccaaaggaggccctgcccctttggcctggtccttgctaccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - crystallin, mu
- homeobox C10
- THO complex 3
- chondroadherin

Buy PIM2-pim-2 oncogene Gene now

Add to cart