Login to display prices
Login to display prices
PIM2-pim-2 oncogene Gene View larger

PIM2-pim-2 oncogene Gene

PTXBC018111

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIM2-pim-2 oncogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIM2-pim-2 oncogene Gene

Proteogenix catalog: PTXBC018111
Ncbi symbol: PIM2
Product name: PIM2-pim-2 oncogene Gene
Size: 2ug
Accessions: BC018111
Gene id: 11040
Gene description: pim-2 oncogene
Synonyms: serine/threonine-protein kinase pim-2; pim-2 oncogene; pim-2h; proto-oncogene Pim-2 (serine threonine kinase); Pim-2 proto-oncogene, serine/threonine kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaccaagcctctacaggggcctcccgcgccccccgggacccccacgccgccgccaggaggcaaggatcgggaagcgttcgaggccgagtatcgactcggccccctcctgggtaaggggggctttggcaccgtcttcgcaggacaccgcctcacagatcgactccaggtggccatcaaagtgattccccggaatcgtgtgctgggctggtcccccttgtcagactcagtcacatgcccactcgaagtcgcactgctatggaaagtgggtgcaggtggtgggcaccctggcgtgatccgcctgcttgactggtttgagacacaggagggcttcatgctggtcctcgagcggcctttgcccgcccaggatctctttgactatatcacagagaagggcccactgggtgaaggcccaagccgctgcttctttggccaagtagtggcagccatccagcactgccattcccgtggagttgtccatcgtgacatcaaggatgagaacatcctgatagacctacgccgtggctgtgccaaactcattgattttggttctggtgccctgcttcatgatgaaccctacactgactttgatgggacaagggtgtacagccccccagagtggatctctcgacaccagtaccatgcactcccggccactgtctggtcactgggcatcctcctctatgacatggtgtgtggggacattccctttgagagggaccaggagattctggaagctgagctccacttcccagcccatgtctccccagactgctgtgccctaatccgccggtgcctggcccccaaaccttcttcccgaccctcactggaagagatcctgctggacccctggatgcaaacaccagccgaggatgtacccctcaacccctccaaaggaggccctgcccctttggcctggtccttgctaccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: