IL24-interleukin 24 Gene View larger

IL24-interleukin 24 Gene

PTXBC009681

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL24-interleukin 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL24-interleukin 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009681
Product type: DNA & cDNA
Ncbi symbol: IL24
Origin species: Human
Product name: IL24-interleukin 24 Gene
Size: 2ug
Accessions: BC009681
Gene id: 11009
Gene description: interleukin 24
Synonyms: C49A; FISP; IL10B; MDA7; MOB5; ST16; interleukin-24; IL-4-induced secreted protein; melanocyte-associated Mda-7; melanoma differentiation-associated gene 7 protein; suppression of tumorigenicity 16 (melanoma differentiation); interleukin 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattttcaacagaggctgcaaagcctgtggactttagccagcagacccttctgccctcctttgctggcgacagcctctcaaatgcagatggttgtgctcccttgcctgggttttaccctgcttctctggagccaggtatcaggggcccagggccaagaattccactttgggccctgccaagtgaagggggttgttccccagaaactgtgggaagccttctgggctgtgaaagacactatgcaagctcaggataacatcacgagtgcccggctgctgcagcaggaggttctgcagaacgtctcggatgctgagagctgttaccttgtccacaccctgctggagttctacttgaaaactgttttcaaaaactaccacaatagaacagttgaagtcaggactctgaagtcattctctactctggccaacaactttgttctcatcgtgtcacaactgcaacccagtcaagaaaatgagatgttttccatcagagacagtgcacacaggcggtttctgctattccggagagcattcaaacagttggacgtagaagcagctctgaccaaagcccttggggaagtggacattcttctgacctggatgcagaaattctacaagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 32
- SIX homeobox 1
- phosducin-like
- homeobox C11

Buy IL24-interleukin 24 Gene now

Add to cart