Login to display prices
Login to display prices
TAGLN3-transgelin 3 Gene View larger

TAGLN3-transgelin 3 Gene

PTXBC015329

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAGLN3-transgelin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAGLN3-transgelin 3 Gene

Proteogenix catalog: PTXBC015329
Ncbi symbol: TAGLN3
Product name: TAGLN3-transgelin 3 Gene
Size: 2ug
Accessions: BC015329
Gene id: 29114
Gene description: transgelin 3
Synonyms: NP22; NP24; NP25; transgelin-3; neuronal protein 22; neuronal protein NP25; transgelin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaacaggggcccgagctatggcttaagccgagaggtgcaggagaagatcgagcagaagtatgatgcggacctggagaacaagctggtggactggatcatcctgcagtgcgccgaggacatagagcacccgccccccggcagggcccattttcagaaatggttaatggacgggacggtcctgtgcaagctgataaatagtttatacccaccaggacaagagcccatacccaagatctcagagtcaaagatggcttttaagcagatggagcaaatctcccagttcctaaaagctgcggagacctatggtgtcagaaccaccgacatctttcagacggtggatctatgggaagggaaggacatggcagctgtgcagaggaccctgatggctttaggcagcgttgcagtcaccaaggatgatggctgctatcggggagagccatcctggtttcacaggaaagcccagcagaatcggagaggcttttccgaggagcagcttcgccagggacagaacgtaataggcctgcagatgggcagcaacaagggagcctcccaggcgggcatgacagggtacgggatgcccaggcagatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice