Login to display prices
Login to display prices
DCTD-dCMP deaminase Gene View larger

DCTD-dCMP deaminase Gene

PTXBC001286

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCTD-dCMP deaminase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCTD-dCMP deaminase Gene

Proteogenix catalog: PTXBC001286
Ncbi symbol: DCTD
Product name: DCTD-dCMP deaminase Gene
Size: 2ug
Accessions: BC001286
Gene id: 1635
Gene description: dCMP deaminase
Synonyms: dCMP deaminase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaagtttcctgcaagaaacgggacgactatttggaatggccagagtattttatggctgtggccttcttatcagcacagagaagcaaagatccaaattcccaggtcggcgcctgcatcgtgaattcagaaaacaagattgtcgggattgggtacaatgggatgccaaatgggtgcagtgatgacgtgttgccttggagaaggacagcagagaataagctggacaccaaatacccgtacgtgtgccatgcggagctgaatgccatcatgaacaaaaatttgaccgatgtgaaaggctgtagtatgtatgtcgccttgttcccttgtaatgaatgcgctaagctcatcatccaggcaggtataaaagaagtgattttcatgtctgataaataccatgatagtgacgaggcaactgctgcgaggctcctgtttaatatggccggggtgacattccggaaattcataccgaagtgcagcaagattgtcattgactttgattcaattaacagcagaccgagtcaaaagcttcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice