TAGLN2-transgelin 2 Gene View larger

TAGLN2-transgelin 2 Gene

PTXBC002616

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAGLN2-transgelin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAGLN2-transgelin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002616
Product type: DNA & cDNA
Ncbi symbol: TAGLN2
Origin species: Human
Product name: TAGLN2-transgelin 2 Gene
Size: 2ug
Accessions: BC002616
Gene id: 8407
Gene description: transgelin 2
Synonyms: HA1756; transgelin-2; SM22-alpha homolog; epididymis tissue protein Li 7e; transgelin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacaggggacctgcatatggcctgagccgggaggtgcagcagaagattgagaaacaatatgatgcagatctggagcagatcctgatccagtggatcaccacccagtgccgaaaggatgtgggccggccccagcctggacgcgagaacttccagaactggctcaaggatggcacggtgctatgtgagctcattaatgcacagtaccccgaggggcaggccccagtaaagaagatccaggcctccaccatggccttcaagcagatggagcagatctctcagttcctgcaagcagctgagcgctatggcattaacaccactgacatcttccaaactgtggacctctgggaaggaaagaacatggcctgtgtgcagcggacgctgatgaatctgggtgggctggcagtagcccgagatgatgggctcttctctggggatcccaactggttccctaagaaatccaaggagaatcctcggaacttctcggataaccagctgcaagagggcaagaacgtgatcgggttacagatgggcaccaaccgcggggcgtctcaggcaggcatgactggctacgggatgccacgccagatcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CXXC finger 5
- mohawk homeobox
- astrotactin 2
- THO complex 1

Buy TAGLN2-transgelin 2 Gene now

Add to cart