CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene View larger

CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014351
Product type: DNA & cDNA
Ncbi symbol: CDC73
Origin species: Human
Product name: CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014351
Gene id: 79577
Gene description: cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Synonyms: C1orf28; FIHP; HPTJT; HRPT1; HYX; parafibromin; Paf1/RNA polymerase II complex component; cell division cycle 73 Paf1/RNA polymerase II complex component-like protein; cell division cycle 73, Paf1/RNA polymerase II complex component, homolog; cell division cycle protein 73 homolog; hyperparathyroidism 2 protein; cell division cycle 73
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagtggaaaaaattgctgcaatcaaagccaaaattatggctaagaaaagatctactatcaagactgatctagatgatgacataactgcccttaaacagaggagttttgtggatgctgaggtagatgtgacccgagatattgtcagcagagagagagtatggaggacacgaacaactatcttacaaagcacaggaaagaatttttccaagaacatttttgcaattcttcaatctgtaaaagccagagaagaagggcgtgcacctgaacagcgacctgccccaaatgcagcacctgtggatcccactttgcgcaccaaacagcctatcccagctgcctataacagatacgatcaggaaagattcaaaggaaaagaagaaacggaaggcttcaaaattgacactatgggaacctaccatggtatgacactgaaatctgtaacggagggtgcatctgcccggaagactcagactcctgcagcccagccagtaccaagaccagtttctcaagcaagacctcccccaaatcagaagaaaggatctcgaacacccattatcataattcctgcagctaccacctctttaataaccatgcttaatgcaaaagaccttctacaggacctgaaatttgtcccatcagatgaaaagaagaaacaaggttgtcaacgagaaaatgaaactctaatacaaagaagaaaagaccagatgcaaccagggggcactgcaattagtgttacagtaccttatagagtagtagaccagccccttaaacttatgcctcaagactgggaccgcgttgtagccgtttttgtgcagggtcctgcatggcagttcaaaggttggccatggcttttgcctgatggatcaccagttgatatatttgctaaaattaaagccttccatctgaagtatgatgaagttcgtctggatccaaatgttcagaaatgggatgtaacagtattagaactcagctatcacaaacgtcatttggatagaccagtgttcttacggttttgggaaacattggacaggtacatggtaaagcataaatcgcacttgagattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5

Buy CDC73-cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene now

Add to cart