Login to display prices
Login to display prices
LILRB5-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 Gene View larger

LILRB5-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 Gene

PTXBC025704

New product

Data sheet of LILRB5-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LILRB5-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC025704
Ncbi symbol: LILRB5
Product name: LILRB5-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 Gene
Size: 2ug
Accessions: BC025704
Gene id: 10990
Gene description: leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
Synonyms: CD85C; LIR-8; LIR8; leukocyte immunoglobulin-like receptor subfamily B member 5; CD85 antigen-like family member C; leucocyte Ig-like receptor B5; leukocyte immunoglobulin-like receptor 8; leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5; leukocyte immunoglobulin like receptor B5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctcaccctctcagtcctgatttgcctcgggctgagtgtgggccccaggacctgcgtgcaggcaggcaccctccccaaacccaccctctgggctgagccagcctctgtgatagctcgggggaagcccgtgaccctctggtgtcaggggcccctggagactgaggagtaccgtctggataaggagggactcccatgggcccggaagagacagaacccactggagcctggagccaaggccaagttccacattccatccacggtgtatgacagtgcagggcgataccgctgctactatgagacccctgcaggctggtcagagcccagtgaccccctggagctggtggcgacaggattctatgcagaacccactcttttagccctgccgagtcctgtggtggcctcaggaggaaatgtgaccctccagtgtgatacactggacggacttctcacgtttgttcttgttgaggaagaacagaagctccccaggaccctgtactcacagaagctccccaaagggccatcccaggccctgttccctgtgggtcccgtgacccccagctgcaggtggaggttcagatgctattactattacaggaaaaaccctcaggtgtggtcgaaccccagtgacctcctggagattctggtcccaggcgtgtctaggaagccctccctcctgatcccgcagggctctgtcgtggcccgcggaggcagcctgaccctgcagtgtcgctctgatgtcggctatgacatattcgttctgtacaaggagggggaacatgacctcgtccagggctctggccagcagccccaggctgggctctcccaggccaacttcaccctgggccctgtgagccgctcccacgggggccagtacagatgctacggtgcacacaacctctcccctaggtggtcggcccccagcgaccccctggacatcctgatcgcaggactgatccctgacatacccgccctctcggtgcagccgggccccaaggtggcctcaggagagaacgtgaccctgctgtgtcagtcatggcatcagatagacactttctttttgaccaaggagggggcagcccatcccccgctgtgtctaaagtcaaagtaccagtcttatagacaccaggctgaattctccatgagtcctgtgacctcagcccagggtggaacctaccgatgctacagcgcaatcaggtcctacccctacctgctgtccagccctagttacccccaggagctcgtggtctcaggaccctctggggatcccagcctctcacctacaggctccacccccacacctggccctgaggaccagcccctcacccccacggggttggatccccagagtggtctgggaaggcacctgggggttgtgactggggtctcagtggccttcgtcctgctgctgttcctcctcctcttcctcctcctccgacatcggcatcagagcaaacacaggacatcggcccatttctaccgtcctgcaggggctgcggggccagagcccaaggaccagggcctgcagaagagggccagcccagttgctgacatccaggaggaaattctcaatgctgccgtgaaggacacacagcccaaggacggggtggagatggatgctcgggctgctgcatctgaagccccccaggatgtgacctacgcccagctacacagcttgaccctcagacgggaggcaactgagcctcctccatcccaggaaagggaacctccagctgaacccagcatctacgcccccctggccatccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: