Login to display prices
Login to display prices
GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene View larger

GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008663
Product type: DNA & cDNA
Ncbi symbol: GNGT2
Origin species: Human
Product name: GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene
Size: 2ug
Accessions: BC008663
Gene id: 2793
Gene description: guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Synonyms: G-GAMMA-8; G-GAMMA-C; GNG8; GNG9; GNGT8; guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2; G protein cone gamma 8 subunit; G-gamma-9; g gamma-C; gamma-T2 subunit; guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2; guanine nucleotide binding protein gamma 9; guanine nucleotide binding protein gamma transducing activity polypeptide 2; G protein subunit gamma transducin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccaggatctcagcgagaaggacctgttgaagatggaggtggagcagctgaagaaagaagtgaaaaacacaagaattccgatttccaaagcgggaaaggaaatcaaggagtacgtggaggcccaagcaggaaacgatccttttctcaaaggcatccctgaggacaagaatcccttcaaggagaaaggtggctgtctgataagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3
- tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
- DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
- guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2