Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene
PTXBC008663
New product
Data sheet of GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNGT2 |
| Origin species: | Human |
| Product name: | GNGT2-guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene |
| Size: | 2ug |
| Accessions: | BC008663 |
| Gene id: | 2793 |
| Gene description: | guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 |
| Synonyms: | G-GAMMA-8; G-GAMMA-C; GNG8; GNG9; GNGT8; guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2; G protein cone gamma 8 subunit; G-gamma-9; g gamma-C; gamma-T2 subunit; guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2; guanine nucleotide binding protein gamma 9; guanine nucleotide binding protein gamma transducing activity polypeptide 2; G protein subunit gamma transducin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccaggatctcagcgagaaggacctgttgaagatggaggtggagcagctgaagaaagaagtgaaaaacacaagaattccgatttccaaagcgggaaaggaaatcaaggagtacgtggaggcccaagcaggaaacgatccttttctcaaaggcatccctgaggacaagaatcccttcaaggagaaaggtggctgtctgataagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) - guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 |