Login to display prices
Login to display prices
SLC35A3-solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 Gene View larger

SLC35A3-solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 Gene

PTXBC005136

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC35A3-solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC35A3-solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 Gene

Proteogenix catalog: PTXBC005136
Ncbi symbol: SLC35A3
Product name: SLC35A3-solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 Gene
Size: 2ug
Accessions: BC005136
Gene id: 23443
Gene description: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3
Synonyms: AMRS; UDP-N-acetylglucosamine transporter; golgi UDP-GlcNAc transporter; solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3; solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3; solute carrier family 35 member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgccaacctaaaatacgtttccctgggaattttggtctttcagactaccagtttggttctaacaatgcgttattccagaactttaaaagaagaaggacctcgttatctatcttctacagcagtggttgttgctgaacttttgaagataatggcctgcattttattggtctacaaagacagcaaatgtagtctaagagcactgaatcgagtactacatgatgaaattcttaataaacctatggaaacacttaaacttgctattccatcagggatctatactcttcagaataatttactgtatgtggcactatcaaatctagatgcagctacttatcaggtcacgtatcagttgaaaattcttacaacagcattattttctgtgtctatgcttagtaaaaaattgggtgtataccagtggctgtccctagtaattttgatgacaggagttgcttttgtacagtggccctcagattctcagcttgattctaaggaactttcagctggttctcaatttgtaggactcatggcagttctcacagcatgtttttcaagtggctttgctggggtttactttgagaaaatcttaaaagaaacaaaacaatcagtgtggataagaaatattcagcttgtgtctttttccttggagccatccttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: