Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S100B-S100 calcium binding protein B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S100B-S100 calcium binding protein B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001766 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S100B |
| Origin species: | Human |
| Product name: | S100B-S100 calcium binding protein B Gene |
| Size: | 2ug |
| Accessions: | BC001766 |
| Gene id: | 6285 |
| Gene description: | S100 calcium binding protein B |
| Synonyms: | NEF; S100; S100-B; S100beta; protein S100-B; S-100 calcium-binding protein, beta chain; S-100 protein subunit beta; S100 calcium-binding protein, beta (neural); S100 calcium binding protein B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgagctggagaaggccatggtggccctcatcgacgttttccaccaatattctggaagggagggagacaagcacaagctgaagaaatccgaactcaaggagctcatcaacaatgagctttcccatttcttagaggaaatcaaagagcaggaggttgtggacaaagtcatggaaacactggacaatgatggagacggcgaatgtgacttccaggaattcatggcctttgttgccatggttactactgcctgccacgagttctttgaacatgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual specificity phosphatase 3 - glutathione S-transferase mu 1 - SAR1 homolog B (S. cerevisiae) - UDP-glucose pyrophosphorylase 2 |