S100B-S100 calcium binding protein B Gene View larger

S100B-S100 calcium binding protein B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100B-S100 calcium binding protein B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about S100B-S100 calcium binding protein B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001766
Product type: DNA & cDNA
Ncbi symbol: S100B
Origin species: Human
Product name: S100B-S100 calcium binding protein B Gene
Size: 2ug
Accessions: BC001766
Gene id: 6285
Gene description: S100 calcium binding protein B
Synonyms: NEF; S100; S100-B; S100beta; protein S100-B; S-100 calcium-binding protein, beta chain; S-100 protein subunit beta; S100 calcium-binding protein, beta (neural); S100 calcium binding protein B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgagctggagaaggccatggtggccctcatcgacgttttccaccaatattctggaagggagggagacaagcacaagctgaagaaatccgaactcaaggagctcatcaacaatgagctttcccatttcttagaggaaatcaaagagcaggaggttgtggacaaagtcatggaaacactggacaatgatggagacggcgaatgtgacttccaggaattcatggcctttgttgccatggttactactgcctgccacgagttctttgaacatgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual specificity phosphatase 3
- glutathione S-transferase mu 1
- SAR1 homolog B (S. cerevisiae)
- UDP-glucose pyrophosphorylase 2

Buy S100B-S100 calcium binding protein B Gene now

Add to cart