Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GSTM1-glutathione S-transferase mu 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTM1-glutathione S-transferase mu 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024005 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTM1 |
| Origin species: | Human |
| Product name: | GSTM1-glutathione S-transferase mu 1 Gene |
| Size: | 2ug |
| Accessions: | BC024005 |
| Gene id: | 2944 |
| Gene description: | glutathione S-transferase mu 1 |
| Synonyms: | GSTM1-1; GST1; GSTM1a-1a; GSTM1b-1b; GTH4; GTM1; MU-1; glutathione S-transferase Mu 1; GST HB subunit 4; GST class-mu 1; HB subunit 4; S-(hydroxyalkyl)glutathione lyase; glutathione S-alkyltransferase; glutathione S-aralkyltransferase; glutathione S-aryltransferase; glutathione S-transferase M1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatgatactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctatgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctgccctacttgattgatggggctcacaagatcacccagagcaacgccatcttgtgctacattgcccgcaagcacaacctgtgtggggagacagaagaggagaagattcgtgtggacattttggagaaccagaccatggacaaccatatgcagctgggcatgatctgctacaatccagaatttgagaaactgaagccaaagtacttggaggaactccctgaaaagctaaagctctactcagagtttctggggaagcggccatggtttgcaggaaacaagggcttggagaagatctctgcctacatgaagtccagccgcttcctcccaagacctgtgttctcaaagatggctgtctggggcaacaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SAR1 homolog B (S. cerevisiae) - UDP-glucose pyrophosphorylase 2 - integrator complex subunit 10 - ADAM metallopeptidase domain 2 |