Login to display prices
Login to display prices
YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene View larger

YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene

PTXBC001359

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001359
Product type: DNA & cDNA
Ncbi symbol: YWHAB
Origin species: Human
Product name: YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene
Size: 2ug
Accessions: BC001359
Gene id: 7529
Gene description: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Synonyms: GW128; HEL-S-1; HS1; KCIP-1; YWHAA; 14-3-3 protein beta/alpha; 14-3-3 alpha; brain protein 14-3-3, beta isoform; epididymis secretory protein Li 1; protein 1054; protein kinase C inhibitor protein-1; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaatggataaaagtgagctggtacagaaagccaaactcgctgagcaggctgagcgatatgatgatatggctgcagccatgaaggcagtcacagaacaggggcatgaactctccaacgaagagagaaatctgctctctgttgcctacaagaatgtggtaggcgcccgccgctcttcctggcgtgtcatctccagcattgagcagaaaacagagaggaatgagaagaagcagcagatgggcaaagagtaccgtgagaagatagaggcagaactgcaggacatctgcaatgatgttctggagctgttggacaaatatcttattcccaatgctacacaaccagaaagtaaggtgttctacttgaaaatgaaaggagattattttaggtatctttctgaagtggcatctggagacaacaaacaaaccactgtgtcgaactcccagcaggcttaccaggaagcatttgaaattagtaagaaagaaatgcagcctacacacccaattcgtcttggtctggcactaaatttctcagtcttttactatgagattctaaactctcctgaaaaggcctgtagcctggcaaaaacggcatttgatgaagcaattgctgaattggatacgctgaatgaagagtcttataaagacagcactctgatcatgcagttacttagggacaatctcactctgtggacatcggaaaaccagggagacgaaggagacgctggggagggagagaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
- guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
- aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
- xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)