Cart 3 Product Products 424,96 € (empty)
-
-
-
1 x CALML3-cal...113,40 €
No products
To be determined Shipping
424,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 424,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 424,96 €
View larger 
DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene
PTXBC035658
New product
Data sheet of DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035658 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DMC1 |
| Origin species: | Human |
| Product name: | DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC035658 |
| Gene id: | 11144 |
| Gene description: | DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) |
| Synonyms: | DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination; meiotic recombination protein DMC1/LIM15 homolog; DMC1H; LIM15; dJ199H16.1; disrupted meiotic cDNA1, yeast, homolog of; DNA meiotic recombinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggaggatcaagttgtggcggaagaaccaggattccaagatgaagaggaatctttgtttcaagatattgacctgttacagaaacatggaattaacgtggctgacattaagaaactgaaatcagtaggaatctgtaccatcaaaggtatacagatgacaacaagaagagctctatgcaatgtcaaaggactctcagaagccaaagtagacaagattaaagaggcagcgaacaaactaattgaaccaggattcttgactgcatttgagtatagtgaaaagaggaaaatggttttccatatcaccaccgggagccaggaatttgataagttactaggaggtggaattgaaagtatggcaattacagaagcttttggagaatttcgtactggaaaaacccagctttctcataccctctgtgtgacagctcaacttccaggagctggtggctacccaggaggaaagattatcttcattgatacagaaaatactttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 - aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) - xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) - asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) |