PTXBC035658
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC035658 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | DMC1 | 
| Origin species: | Human | 
| Product name: | DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene | 
| Size: | 2ug | 
| Accessions: | BC035658 | 
| Gene id: | 11144 | 
| Gene description: | DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) | 
| Synonyms: | DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination; meiotic recombination protein DMC1/LIM15 homolog; DMC1H; LIM15; dJ199H16.1; disrupted meiotic cDNA1, yeast, homolog of; DNA meiotic recombinase 1 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgaaggaggatcaagttgtggcggaagaaccaggattccaagatgaagaggaatctttgtttcaagatattgacctgttacagaaacatggaattaacgtggctgacattaagaaactgaaatcagtaggaatctgtaccatcaaaggtatacagatgacaacaagaagagctctatgcaatgtcaaaggactctcagaagccaaagtagacaagattaaagaggcagcgaacaaactaattgaaccaggattcttgactgcatttgagtatagtgaaaagaggaaaatggttttccatatcaccaccgggagccaggaatttgataagttactaggaggtggaattgaaagtatggcaattacagaagcttttggagaatttcgtactggaaaaacccagctttctcataccctctgtgtgacagctcaacttccaggagctggtggctacccaggaggaaagattatcttcattgatacagaaaatactttgtaa | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 - aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) - xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) - asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) |