DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene View larger

DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene

PTXBC035658

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035658
Product type: DNA & cDNA
Ncbi symbol: DMC1
Origin species: Human
Product name: DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene
Size: 2ug
Accessions: BC035658
Gene id: 11144
Gene description: DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)
Synonyms: DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination; meiotic recombination protein DMC1/LIM15 homolog; DMC1H; LIM15; dJ199H16.1; disrupted meiotic cDNA1, yeast, homolog of; DNA meiotic recombinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggaggatcaagttgtggcggaagaaccaggattccaagatgaagaggaatctttgtttcaagatattgacctgttacagaaacatggaattaacgtggctgacattaagaaactgaaatcagtaggaatctgtaccatcaaaggtatacagatgacaacaagaagagctctatgcaatgtcaaaggactctcagaagccaaagtagacaagattaaagaggcagcgaacaaactaattgaaccaggattcttgactgcatttgagtatagtgaaaagaggaaaatggttttccatatcaccaccgggagccaggaatttgataagttactaggaggtggaattgaaagtatggcaattacagaagcttttggagaatttcgtactggaaaaacccagctttctcataccctctgtgtgacagctcaacttccaggagctggtggctacccaggaggaaagattatcttcattgatacagaaaatactttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
- aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
- xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)
- asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)

Buy DMC1-DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene now

Add to cart