Login to display prices
Login to display prices
ALG3-asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) Gene View larger

ALG3-asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) Gene

PTXBC002839

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG3-asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALG3-asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC002839
Ncbi symbol: ALG3
Product name: ALG3-asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC002839
Gene id: 10195
Gene description: asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
Synonyms: ALG3, alpha-1,3- mannosyltransferase; CDG1D; CDGS4; CDGS6; D16Ertd36e; NOT56L; Not56; not; dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase; Not56-like protein; asparagine-linked glycosylation 3 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase); asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog; asparagine-linked glycosylation protein 3 homolog; carbohydrate deficient glycoprotein syndrome type IV; dol-P-Man-dependent alpha(1-3)-mannosyltransferase; dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase; dolichyl-phosphate-mannose--glycolipid alpha-mannosyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgggctgcggaaacgcggccggtccggttccgcggcccaggcagagggactctgcaagcaatggctgcagcgcgcctggcaagagcggcgcctgctgctgcgggagccgcgctacacgctgctggtggccgcctgcctctgcctggcggaggtgggcatcaccttctgggtcattcacagggtggcatacacagagattgactggaaggcctacatggccgaggtagaaggcgtcatcaatggtacctatgactatacccaactgcagggtgacaccggaccacttgtgtacccagctggtttcgtgtacatctttatggggttgtactatgccaccagccgaggcactgacatccgcatggcccagaacatctttgctgtgctctacctggctaccttgctgcttgtcttcttgatctatcaccagacctgcaaggtacctcccttcgtctttttcttcatgtgctgcgcctcttaccgtgtccactccatctttgtgctgcggctcttcaatgacccagtggccatggtgctgctcttcctcagtatcaacctcctgctggcccagcgctggggctggggttgctgctttttcagcctggcagtctctgtgaagatgaatgtgctgctcttcgcccctgggttactgtttcttctcctcacacagtttggcttccgtggggccctccccaagctgggaatctgtgctggccttcaggtggtgctggggctgcccttcctgctggagaaccccagcggctacctgtcccgctcctttgaccttggccgccagtttctgttccactggacagtgaactggcgcttcctcccagaggcgctcttcctgcatcgagccttccacctggccctgttgactgcccacctcaccctgctcctgctgtttgccctctgcaggtggcacaggacaggggaaagtatcttgtcgctgctgagggatccctccaaaaggaaggttccaccccagccccttacacccaaccagatcgtttctaccctcttcacctccaacttcattggcatctgcttcagccgctccctccactaccagttctacgtctggtatttccacacactgccctacctcctgtgggccatgcctgcacgctggctcacacacctgctcaggttgttggtgctggggctcatcgagctctcctggaacacatacccttccacatcctgcagctctgctgccctgcacatatgccatgccgtcatcctgctgcagctctggctgggcccgcagcctttccccaagagcacccaacacagcaagaaagcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: