Login to display prices
Login to display prices
GNAI2-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Gene View larger

GNAI2-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAI2-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNAI2-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014627
Product type: DNA & cDNA
Ncbi symbol: GNAI2
Origin species: Human
Product name: GNAI2-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Gene
Size: 2ug
Accessions: BC014627
Gene id: 2771
Gene description: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Synonyms: GIP; GNAI2B; H_LUCA15.1; H_LUCA16.1; guanine nucleotide-binding protein G(i) subunit alpha-2; GTP-binding regulatory protein Gi alpha-2 chain; adenylate cyclase-inhibiting G alpha protein; guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2; guanine nucleotide-binding protein G(i), alpha-2 subunit; G protein subunit alpha i2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcaccgtgagcgccgaggacaaggcggcggccgagcgctctaagatgatcgacaagaacctgcgggaggacggagagaaggcggcgcgggaggtgaagttgctgctgttgggtgctgtggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgaggatggctactccgaggaggaatgccggcagtaccgggcggttgtctacagcaacaccatccagtccatcatggccattgtcaaagccatgggcaacctgcagatcgactttgccgacccctccagagcggacgacgccaggcagctatttgcactgtcctgcaccgccgaggagcaaggcgtgctccctgatgacctgtccggcgtcatccggaggctctgggctgaccatggtgtgcaggcctgctttggccgctcaagggaataccagctcaacgactcagctgcctactacctgaacgacctggagcgtattgcacagagtgactacatccccacacagcaagatgtgctacggacccgcgtaaagaccacggggatcgtggagacacacttcaccttcaaggacctacacttcaagatgtttgatgtgggtggtcagcggtctgagcggaagaagtggatccactgctttgagggcgtcacagccatcatcttctgcgtagccttgagcgcctatgacttggtgctagctgaggacgaggagatgaaccgcatgcatgagagcatgaagctattcgatagcatctgcaacaacaagtggttcacagacacgtccatcatcctcttcctcaacaagaaggacctgtttgaggagaagatcacacacagtcccctgaccatctgcttccctgagtacacaggggccaacaaatatgatgaggcagccagctacatccagagtaagtttgaggacctgaataagcgcaaagacaccaaggagatctacacgcacttcacgtgcgccaccgacaccaagaacgtgcagttcgtgtttgacgccgtcaccgatgtcatcatcaagaacaacctgaaggactgcggcctcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
- asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
- asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
- mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B