ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene View larger

ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene


New product

Data sheet of ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001133
Product type: DNA & cDNA
Ncbi symbol: ALG8
Origin species: Human
Product name: ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001133
Gene id: 79053
Gene description: asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
Synonyms: ALG8, alpha-1,3-glucosyltransferase; CDG1H; HUSSY-02; asparagine-linked glycosylation 8 alpha-13-glucosyltransferase-like protein; asparagine-linked glycosylation 8 homolog (S. cerevisiae, alpha-1,3-glucosyltransferase); asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase); asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog; asparagine-linked glycosylation protein 8 homolog; dol-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichyl alpha-1,3-glucosyltransferase; dolichyl pyrophosphate Glc1Man9GlcNAc2 alpha-1,3-glucosyltransferase; dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase; dolichyl-P-Glc:Glc1Man9GlcNAc2-PP-dolichyl glucosyltransferase; dolichyl-P-glucose:Glc1Man9GlcNAc2-PP-dolichyl-alpha-1,3-glucosyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgctcacaattgccacgggtactggcaattggttttcggctttggcgctcggggtgactcttctcaaatgccttctcatccccacataccattccacagattttgaagtacaccgaaactggcttgctatcactcacagtttgccaatatcacagtggtattatgaggcaacttcagagtggacgttggattacccccctttctttgcatggtttgagtatatcctgtcacatgttgccaaatattttgatcaagaaatgctgaatgtccataatttgaattactccagctcaaggaccttacttttccagagattttccgtcatctttatggatgtactctttgtgtatgctgtccgtgagtgctgtaaatgcattgatggaaaaaaagtgggtaaagaacttacagaaaagccaaaatttattctgtcggtattacttctgtggaacttcgggttattaattgtggaccatattcattttcagtacaatggctttttatttggattaatgctactctccattgcacgattatttcagaaaaggcatatggaaggagcatttctctttgctgttctcctacatttcaagcatatctacctctatgtagcaccagcttatggtgtatatctgctgcgatcctactgtttcactgcaaataaaccagatgggtctattcgatggaagagtttcagctttgttcgtgttatttccctgggactggttgttttcttagtttctgctctttcattgggtcctttcctggccttgaatcagctgcctcaagtcttttcccgactctttcctttcaagaggggcctctgtcatgcatattgggctccaaacttctgggctttgtacaatgctttggacaaagtgctgtctgtcatcggtttgaaattgaaatttcttgatcccaacaatattcccaaggcctcaatgacaagtggtttggttcagcagttccaacacacagtccttccctcagtgactcccttggcaaccctcatctgcacactgattgccatattgccctctattttctgtctttggtttaaaccccaagggcccagaggctttctccgatgtctaactctttgtgccttgagctcctttatgtttgggtggcatgttcatgaaaaagccatacttctagcaattctcccaatgagccttttgtctgtgggaaaagcaggagacgcttcgatttttctgattctgaccacaacaggacattattccctctttcctctgctcttcactgcaccagaacttcccattaaaatcttactcatgttactattcaccatatatagtatttcgtcactgaagactttattcagaaaagaaaaacctctttttaattggatggaaactttctacctgcttggcctggggcctctggaagtctgctgtgaatttgtattccctttcacctcctggaaggtgaagtaccccttcatccctttgttactaacctcagtgtattgtgcagtaggcgtcacatatgcttggttcaaactgtatgtttcagtattgattgactctgctattggcaagacaaagaaacaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
- mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
- guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1

Buy ALG8-asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) Gene now

Add to cart