Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene
PTXBC030027
New product
Data sheet of GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030027 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNAO1 |
| Origin species: | Human |
| Product name: | GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene |
| Size: | 2ug |
| Accessions: | BC030027 |
| Gene id: | 2775 |
| Gene description: | guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O |
| Synonyms: | EIEE17; G-ALPHA-o; GNAO; HLA-DQB1; guanine nucleotide-binding protein G(o) subunit alpha; GO2-q chimeric G-protein; guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O; guanine nucleotide-binding regulatory protein 2; G protein subunit alpha o1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 - TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa - asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) - adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 |