GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene View larger

GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030027
Product type: DNA & cDNA
Ncbi symbol: GNAO1
Origin species: Human
Product name: GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene
Size: 2ug
Accessions: BC030027
Gene id: 2775
Gene description: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Synonyms: EIEE17; G-ALPHA-o; GNAO; HLA-DQB1; guanine nucleotide-binding protein G(o) subunit alpha; GO2-q chimeric G-protein; guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O; guanine nucleotide-binding regulatory protein 2; G protein subunit alpha o1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
- TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
- asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
- adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2

Buy GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene now

Add to cart