Login to display prices
Login to display prices
GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene View larger

GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene

PTXBC030027

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene

Proteogenix catalog: PTXBC030027
Ncbi symbol: GNAO1
Product name: GNAO1-guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Gene
Size: 2ug
Accessions: BC030027
Gene id: 2775
Gene description: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Synonyms: EIEE17; G-ALPHA-o; GNAO; HLA-DQB1; guanine nucleotide-binding protein G(o) subunit alpha; GO2-q chimeric G-protein; guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O; guanine nucleotide-binding regulatory protein 2; G protein subunit alpha o1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: