APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene View larger

APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene


New product

Data sheet of APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033731
Product type: DNA & cDNA
Ncbi symbol: APPL2
Origin species: Human
Product name: APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene
Size: 2ug
Accessions: BC033731
Gene id: 55198
Gene description: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms: DIP13B; DCC-interacting protein 13-beta; DIP13 beta; adapter protein containing PH domain, PTB domain and leucine zipper motif 2; adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2; adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgccgtggacaagctcctgctagaggaggcgttgcaggacagcccccagactcgctctttactgagcgtgtttgaagaagatgctggcaccctcacagactataccaaccagctgctccaggcaatgcagcgcgtctatggagcccagaatgagatgtgcctggccacacaacagctttctaagcaactgctggcatatgaaaaacagaactttgctcttggcaaaggtgatgaagaagtaatttcaacactccactatttttccaaagtggtggatgagcttaatcttctccatacagagctggctaaacagttggcagacacaatggttctacctatcatacaattccgagaaaaggatctcacagaagtaagcactttaaaggatctatttggactcgctagcaatgagcatgacctctcaatggcaaaatacagcaggctgcctaagaaaaaggagaatgagaaggtgaagaccgaagtcggaaaagaggtggccgcggcccggcggaagcagcatctctcctcccttcagtactactgtgccctcaacgcgctgcagtacagaaagcaaatggccatgatggagcccatgataggctttgcccatggacagattaacttttttaagaagggagcagagatgttttccaaacgtatggacagctttttatcctccgttgcagacatggttcaaagcattcaggtagaactggaagccgaggcggaaaagatgcgggtgtcccagcaagaattactttctgttgatgaatctgtttacactccagactctgatgtggccgcaccacagatcaacaggaacctcatccagaaggctggttaccttaatcttagaaacaaaacagggctggtcaccaccacctgggagaggctttatttcttcacccaaggcgggaatctcatgtgtcagcccaggggagccgtggctggaggtttgatccaggacctggacaactgctcagtgatggccgtggattgcgaagaccggcgctactgcttccagatcaccacgcccaatggaaaatcgggaataatcctccaggctgagagcagaaaggaaaatgaagagtggatatgtgcaataaacaacatctccagacagatctacctgaccgacaaccctgaggcagtcgcgatcaagttgaatcagaccgctctgcaagcagtgactcccattacaagttttggaaaaaaacaagaaagctcatgccccagccagaacctgaaaaattcagagatggaaaatgaaaatgacaagattgttcccaaagtaacagccagtctacctgaagcagaggagctgatcgcgcctggaacgccgattcaattcgatattgtgcttcctgctacagaattccttgatcagaacagagggagcaggcgtaccaacccttttggtgaaactgaggatgaatcatttccagaagcagaagattctcttttgcagcagatgtttatagttcggtttttgggatcaatggcagttaaaacagacagcactactgaagtgatttatgaagcgatgagacaagtattggctgctcgggctattcataacatcttccgcatgacagaatcccatctgatggtcaccagtcaatctttgaggttgatagatccacagactcaagtatcaagggccaattttgaacttaccagtgtcacacaatttgctgctcatcaagaaaacaagagactggttggttttgtcatccgtgttcctgaatccactggagaagaatctctgagtacatacatttttgaaagcaactcagaaggcgaaaagatatgttatgctattaatttgggaaaagaaattattgaggttcagaaggatccagaagcactggctcaattaatgctgtccataccactaaccaatgatggaaaatatgtactgttaaacgatcaaccagatgacgatgatggaaatccaaatgaacatagaggcgcagaatccgaagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
- hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
- transient receptor potential cation channel, subfamily C, member 4 associated protein

Buy APPL2-adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 Gene now

Add to cart