TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene View larger

TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene


New product

Data sheet of TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013144
Product type: DNA & cDNA
Ncbi symbol: TRPC4AP
Origin species: Human
Product name: TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene
Size: 2ug
Accessions: BC013144
Gene id: 26133
Gene description: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: C20orf188; PPP1R158; TRRP4AP; TRUSS; short transient receptor potential channel 4-associated protein; TNF-receptor ubiquitous scaffolding/signaling protein; TRP4-associated protein; protein phosphatase 1, regulatory subunit 158; trpc4-associated protein; tumor necrosis factor receptor-associated ubiquitous scaffolding and signaling protein; transient receptor potential cation channel subfamily C member 4 associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcgccggtagcggctgggtctggagccggccgagggagacggtcggcagccacagtggcggcttggggcggatggggcggccggccgcggcctggtaacattctgctgcagctgcggcagggccagctgaccggccggggcctggtccgggcggtgcagttcactgagacttttttgacggagagggacaaacaatccaagtggagtggaattcctcagctgctcctcaagctgcacaccaccagccacctccacagtgactttgttgagtgtcaaaacatcctcaaggaaatttctcctcttctctccatggaggctatggcatttgttactgaagagaggaaacttacccaagaaaccacttatccaaatacttatatttttgacttgtttggaggtgttgatcttcttgtagaaattcttatgaggcctacgatctctatccggggacagaaactgaaaataagtgatgaaatgtccaaggactgcttgagtatcctgtataatacctgtgtctgtacagagggagttacaaagcgtttggcagaaaagaatgactttgtgatcttcctgtttacattgatgacaagtaagaagacattcttacaaacagcaaccctcattgaagatattttgggtgttaaaaaggaaatgatccgactagatgaagtccccaatctgagttccttagtatccaatttcgatcagcagcagctcgctaatttctgccggattctggctgtcaccatttcagagatggatacagggaatgatgacaagcacacgcttcttgccaaaaatgctcaacagaagaagagcttgagtttggggccttctgcagctgaaatcaatcaagcggcccttctcagcattcctggctttgttgagcggctttgcaaactggcgactcgaaaggtgtcagagtcaacgggcacagccagcttccttcaggagttggaagagtggtacacatggctagacaatgctttggtgctagatgccctgatgcgagtggccaatgaggagtcagagcacaatcaagcctccattgtgttccctcctccaggggcttctgaggagaatggcctgcctcacacgtcagccagaacccagctgccccagtcaatgaagattatgcatgagatcatgtacaaactggaagtgctctatgtcctctgcgtgctgctgatggggcgtcagcgaaaccaggttcacagaatgattgcagagttcaagctgatccctggacttaataatttgtttgacaaactgatttggaggaagcattcagcatctgcccttgtcctccatggtcacaaccagaactgtgactgtagcccggacatcaccttgaagatacagtttttgaggcttcttcagagcttcagtgaccaccacgagaacaagtacttgttactcaacaaccaggagctgaatgaactcagtgccatctctctcaaggccaacatccctgaggtggaagctgtcctcaacaccgacaggagtttggtgtgtgatgggaagaggggcttattaactcgtctgctgcaggtcatgaagaaggagccagcagagtcgtctttcaggttttggcaagctcgggctgtggagagtttcctccgagggaccacctcctatgcagaccagatgttcctgctgaagcgaggcctcttggagcacatcctttactgcattgtggacagcgagtgtaagtcaagggatgtgctccagagttactttgacctcctgggggagctgatgaagttcaacgttgatgcattcaagagattcaataaatatatcaacaccgatgcaaagttccaggtattcctgaagcagatcaacagctccctggtggactccaacatgctggtgcgctgtgtcactctgtccctggaccgatttgaaaaccaggtggatatgaaagttgccgaggtactgtctgaatgccgcctgctcgcctacatatcccaggtgcccacgcagatgtccttcctcttccgcctcatcaacatcatccacgtgcagacgctgacccaggagaacgtcagctgcctcaacaccagcctggtgatcctgatgctggcccgacggaaagagcggctgcccctgtacctgcggctgctgcagcggatggagcacagcaagaagtaccccggcttcctgctcaacaacttccacaacctgctgcgcttctggcagcagcactacctgcacaaggacaaggacagcacctgcctagagaacagctcctgcatcagcttctcatactggaaggagacagtgtccatcctgttgaacccggaccggcagtcaccctctgctctcgttagctacattgaggagccctacatggacatagacagggacttcactgaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
- ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1

Buy TRPC4AP-transient receptor potential cation channel, subfamily C, member 4 associated protein Gene now

Add to cart