Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAC2-ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) Gene
PTXBC001485
New product
Data sheet of RAC2-ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAC2-ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001485 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAC2 |
| Origin species: | Human |
| Product name: | RAC2-ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) Gene |
| Size: | 2ug |
| Accessions: | BC001485 |
| Gene id: | 5880 |
| Gene description: | ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) |
| Synonyms: | ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2); Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP-binding protein Rac2); p21-Rac2; EN-7; HSPC022; ras-related C3 botulinum toxin substrate 2; small G protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggccatcaagtgtgtggtggtgggagatggggccgtgggcaagacctgccttctcatcagctacaccaccaacgcgtttcccggagagtacatccccaccgtgtttgacaactattcagccaatgtgatggtggacagcaagccagtgaacctggggctgtgggacactgctgggcaggaggactacgaccgtctccggccgctctcctatccacagacggacgtcttcctcatctgcttctccctcgtcagcccagcctcttatgagaacgtccgcgccaagtggttcccagaagtgcggcaccactgccccagcacacccatcatcctggtgggcaccaagctggacctgcgggacgacaaggacaccatcgagaaactgaaggagaagaagctggctcccatcacctacccgcagggcctggcactggccaaggagattgactcggtgaaatacctggagtgctcagctctcacccagagaggcctgaaaaccgtgttcgacgaggccatccgggccgtgctgtgccctcagcccacgcggcagcagaagcgcgcctgcagcctcctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 - asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) |