SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene View larger

SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003559
Product type: DNA & cDNA
Ncbi symbol: SERPINA3
Origin species: Human
Product name: SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene
Size: 2ug
Accessions: BC003559
Gene id: 12
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
Synonyms: AACT; ACT; GIG24; GIG25; alpha-1-antichymotrypsin; cell growth-inhibiting gene 24/25 protein; growth-inhibiting protein 24; growth-inhibiting protein 25; serine (or cysteine) proteinase inhibitor, clade A, member 3; serpin A3; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3; serpin family A member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagaatgttacctctcctggctctggggctcttggcggctgggttctgccctgctgtcctctgccaccctaacagcccacttgacgaggagaatctgacccaggagaaccaagaccgagggacacacgtggacctcggattagcctccgccaacgtggacttcgctttcagcctgtacaagcagttagtcctgaaggcccctgataagaatgtcatcttctccccactgagcatctccaccgccttggccttcctgtctctgggggcccataataccaccctgacagagattctcaaaggcctcaagttcaacctcacggagacttctgaggcagaaattcaccagagcttccagcacctcctgcgcaccctcaatcagtccagcgatgagctgcagctgagtatgggaaatgccatgtttgtcaaagagcaactcagtctgctggacaggttcacggaggatgccaagaggctgtatggctccgaggcctttgccactgactttcaggactcagctgcagctaagaagctcatcaacgactacgtgaagaatggaactagggggaaaatcacagatctgatcaaggaccttgactcgcagacaatgatggtcctggtgaattacatcttctttaaagccaaatgggagatgccctttgacccccaagatactcatcagtcaaggttctacttgagcaagaaaaagtgggtaatggtgcccatgatgagtttgcatcacctgactataccttacttccgggacgaggagctgtcctgcaccgtggtggagctgaagtacacaggcaatgccagcgcactcttcatcctccctgatcaagacaagatggaggaagtggaagccatgctgctcccagagaccctgaagcggtggagagactctctggagttcagagagataggtgagctctacctgccaaagttttccatctcgagggactataacctgaacgacatacttctccagctgggcattgaggaagccttcaccagcaaggctgacctgtcagggatcacaggggccaggaacctagcagtctcccaggtggtccataaggctgtgcttgatgtatttgaggagggcacagaagcatctgctgccacagcagtcaaaatcaccctcctttctgcattagtggagacaaggaccattgtgcgtttcaacaggcccttcctgatgatcattgtccctacagacacccagaacatcttcttcatgagcaaagtcaccaatcccaagcaagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
- ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
- CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)

Buy SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene now

Add to cart