Login to display prices
Login to display prices
CALM2-calmodulin 2 (phosphorylase kinase, delta) Gene View larger

CALM2-calmodulin 2 (phosphorylase kinase, delta) Gene

PTXBC008437

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALM2-calmodulin 2 (phosphorylase kinase, delta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CALM2-calmodulin 2 (phosphorylase kinase, delta) Gene

Proteogenix catalog: PTXBC008437
Ncbi symbol: CALM2
Product name: CALM2-calmodulin 2 (phosphorylase kinase, delta) Gene
Size: 2ug
Accessions: BC008437
Gene id: 805
Gene description: calmodulin 2 (phosphorylase kinase, delta)
Synonyms: CAMII; LQT15; PHKD; PHKD2; caM; calmodulin; LP7057 protein; calmodulin 2 (phosphorylase kinase, delta); phosphorylase kinase delta; phosphorylase kinase subunit delta; prepro-calmodulin 2; calmodulin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccaactgactgaagagcagattgcagaattcaaagaagctttttcactatttgacaaagatggtgatggaactataacaacaaaggaattgggaactgtaatgagatctcttgggcagaatcccacagaagcagagttacaggacatgattaatgaagtagatgctgatggtaatggcacaattgacttccctgaatttctgacaatgatggcaagaaaaatgaaagacacagacagtgaagaagaaattagagaagcattccgtgtgtttgataaggatggcaatggctatattagtgctgcagaacttcgccatgtgatgacaaaccttggagagaagttaacagatgaagaagttgatcaaatgatcagggaagcagatattgatggtgatggtcaagtaaactatgaagagtttgtacaaatgatgacagcaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice