Login to display prices
Login to display prices
HSD11B1-hydroxysteroid (11-beta) dehydrogenase 1 Gene View larger

HSD11B1-hydroxysteroid (11-beta) dehydrogenase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD11B1-hydroxysteroid (11-beta) dehydrogenase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSD11B1-hydroxysteroid (11-beta) dehydrogenase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012593
Product type: DNA & cDNA
Ncbi symbol: HSD11B1
Origin species: Human
Product name: HSD11B1-hydroxysteroid (11-beta) dehydrogenase 1 Gene
Size: 2ug
Accessions: BC012593
Gene id: 3290
Gene description: hydroxysteroid (11-beta) dehydrogenase 1
Synonyms: 11-DH; 11-beta-HSD1; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1; corticosteroid 11-beta-dehydrogenase isozyme 1; short chain dehydrogenase/reductase family 26C member 1; hydroxysteroid 11-beta dehydrogenase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttttatgaaaaaatatctcctccccattctggggctcttcatggcctactactactattctgcaaacgaggaattcagaccagagatgctccaaggaaagaaagtgattgtcacaggggccagcaaagggatcggaagagagatggcttatcatctggcgaagatgggagcccatgtggtggtgacagcgaggtcaaaagaaactctacagaaggtggtatcccactgcctggagcttggagcagcctcagcacactacattgctggcaccatggaagacatgaccttcgcagagcaatttgttgcccaagcaggaaagctcatgggaggactagacatgctcattctcaaccacatcaccaacacttctttgaatctttttcatgatgatattcaccatgtgcgcaaaagcatggaagtcaacttcctcagttacgtggtcctgactgtagctgccttgcccatgctgaagcagagcaatggaagcattgttgtcgtctcctctctggctgggaaagtggcttatccaatggttgctgcctattctgcaagcaagtttgctttggatgggttcttctcctccatcagaaaggaatattcagtgtccagggtcaatgtatcaatcactctctgtgttcttggcctcatagacacagaaacagccatgaaggcagtttctgggatagtccatatgcaagcagctccaaaggaggaatgtgccctggagatcatcaaagggggagctctgcgccaggaagaagtgtattatgacagctcactctggaccactcttctgatcagaaatccatgcaggaagatcctggaatttctctactcaacgagctataatatggacagattcataaacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding protein S1, serine-rich domain
- phosphodiesterase 4D interacting protein
- ankyrin repeat, family A (RFXANK-like), 2
- mitogen-activated protein kinase kinase 6