RNPS1-RNA binding protein S1, serine-rich domain Gene View larger

RNPS1-RNA binding protein S1, serine-rich domain Gene

PTXBC001659

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNPS1-RNA binding protein S1, serine-rich domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNPS1-RNA binding protein S1, serine-rich domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001659
Product type: DNA & cDNA
Ncbi symbol: RNPS1
Origin species: Human
Product name: RNPS1-RNA binding protein S1, serine-rich domain Gene
Size: 2ug
Accessions: BC001659
Gene id: 10921
Gene description: RNA binding protein S1, serine-rich domain
Synonyms: E5.1; RNA-binding protein with serine-rich domain 1; RNA binding protein with serine-rich domain; RNA-binding protein S1, serine-rich domain; SR protein; SR-related protein LDC2; RNA binding protein with serine rich domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatttatcaggagtgaaaaagaagagcttgctaggagtcaaagaaaataataaaaagtccagcactagggctccttcacctaccaaacgcaaagaccgctcagatgagaagtccaaggatcgctcaaaagataaaggggccaccaaggagtcgagtgagaaggatcgcggccgggacaaaacccgaaagaggcgcagcgcttccagtggtagcagcagtaccaggtctcggtccagctcgacttccagctcaggctccagcaccagcactggctcaagcagtggctccagctcttcctcagcatccagccgctcaggaagctccagcacctcccgcagctccagctctagcagctcttctggctctccaagtccttctcggcgcagacacgacaacaggaggcgctcccgctccaaatccaaaccacctaaaagagatgaaaaggagaggaaaaggcggagcccatctcctaagcccaccaaagtgcacattgggagactcacccggaatgtgacaaaggatcacatcatggagatattttccacctatgggaaaattaaaatgattgacatgcccgtggaaaggatgcatccccatctgtccaaaggctatgcgtacgtagagtttgagaatccagatgaagccgagaaggcgctgaagcacatggatggaggacaaattgatggccaggagatcactgccaccgccgtgctggccccctggcctaggccaccccccaggagattcagccctcccaggagaatgttgccaccaccgcctatgtggcgcaggtctcccccacggatgaggagaaggtcccgctccccgaggcgcaggtcccccgtgcgccggagatcacggtccccgggccgccgccgccacaggagccgctccagctccaactcctcccgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphodiesterase 4D interacting protein
- ankyrin repeat, family A (RFXANK-like), 2
- mitogen-activated protein kinase kinase 6
- SLIT-ROBO Rho GTPase activating protein 3

Buy RNPS1-RNA binding protein S1, serine-rich domain Gene now

Add to cart