ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene View larger

ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene

PTXBC012917

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012917
Product type: DNA & cDNA
Ncbi symbol: ANKRA2
Origin species: Human
Product name: ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene
Size: 2ug
Accessions: BC012917
Gene id: 57763
Gene description: ankyrin repeat, family A (RFXANK-like), 2
Synonyms: ankyrin repeat family A protein 2; RFXANK-like protein 2; ankyrin repeat, family A (RFXANK-like), 2; ankyrin repeat family A member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatacatcaacaaatctggatattggagcccagcttatcgtggaagagtgtcccagcacttatagcctaactggcatgccagacattaaaatagaacatccactggacccaaattcagaagaagggtcagctcagggtgttgccatgggaatgaaattcatattgcctaaccgatttgatatgaatgtgtgttctcgatttgtgaagtccttaaatgaagaagatagtaaaaatattcaagatcaggttaactctgacctggaggtggcatctgtcctatttaaagctgaatgcaatatccatacatctccttctccgggaattcaagtaaggcatgtctacaccccctctacaacaaagcatttctcacccataaaacagtcaaccactttaaccaacaaacacagaggaaatgaggtctctaccacacctctgttagcaaattctttgtctgttcaccagttggctgctcagggagagatgctctatctggctactcgtatcgaacaagaaaatgttatcaatcacacggatgaagaaggatttactcctctgatgtgggctgcagcacacgggcaaatagctgtggtagagttcctacttcagaatggtgctgatccccaacttttaggaaaaggtcgagaaagtgcactgtcgttggcctgtagtaaaggctacacagatattgtcaaaatgctgcttgattgtggagttgatgtaaatgaatatgattggaatggaggaacacctctgctttatgctgtacatggaaatcatgtgaaatgtgtaaagatgctcttagaaagtggggctgatccaacaattgaaactgactctggatataattctatggatctagctgtagccctaggctatagaagtgttcaacaggttattgagtcacatttgttgaagctgcttcaaaatatcaaggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase kinase 6
- SLIT-ROBO Rho GTPase activating protein 3
- lectin, galactoside-binding, soluble, 12
- malate dehydrogenase 2, NAD (mitochondrial)

Buy ANKRA2-ankyrin repeat, family A (RFXANK-like), 2 Gene now

Add to cart