MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene View larger

MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001917
Product type: DNA & cDNA
Ncbi symbol: MDH2
Origin species: Human
Product name: MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene
Size: 2ug
Accessions: BC001917
Gene id: 4191
Gene description: malate dehydrogenase 2, NAD (mitochondrial)
Synonyms: M-MDH; MDH; MGC:3559; MOR1; malate dehydrogenase, mitochondrial; malate dehydrogenase 2, NAD (mitochondrial); testicular tissue protein Li 120; malate dehydrogenase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctctccgccctcgcccggcctgtcagcgctgctctccgccgcagcttcagcacctcggcccagaacaatgctaaagtagctgtgctaggggcctctggaggcatcgggcagccactttcacttctcctgaagaacagccccttggtgagccgcctgaccctctatgatatcgcgcacacacccggagtggccgcagatctgagccacatcgagaccaaagccgctgtgaaaggctacctcggacctgaacagctgcctgactgcctgaaaggttgtgatgtggtagttattccggctggagtccccagaaagccaggcatgacccgggacgacctgttcaacaccaatgccacgattgtggccaccctgaccgctgcctgtgcccagcactgcccggaagccatgatctgcgtcattgccaatccggttaattccaccatccccatcacagcagaagttttcaagaagcatggagtgtacaaccccaacaaaatcttcggcgtgacgaccctggacatcgtcagagccaacacctttgttgcagagctgaagggtttggatccagctcgagtcaacgtccctgtcattggtggccatgctgggaagaccatcatccccctgatctctcagtgcacccccaaggtggactttccccaggaccagctgacagcactcactgggcggatccaggaggccggcacggaggtggtcaaggctaaagccggagcaggctctgccaccctctccatggcgtatgccggcgcccgctttgtcttctcccttgtggatgcaatgaatggaaaggaaggtgttgtggaatgttccttcgttaagtcacaggaaacggaatgtacctacttctccacaccgctgctgcttgggaaaaagggcatcgagaagaacctgggcatcggcaaagtctcctcttttgaggagaagatgatctcggatgccatccccgagctgaaggcctccatcaagaagggggaagatttcgtgaagaccctgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 7
- mitogen-activated protein kinase kinase 3
- receptor-associated protein of the synapse
- replication factor C (activator 1) 4, 37kDa

Buy MDH2-malate dehydrogenase 2, NAD (mitochondrial) Gene now

Add to cart