LGALS12-lectin, galactoside-binding, soluble, 12 Gene View larger

LGALS12-lectin, galactoside-binding, soluble, 12 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LGALS12-lectin, galactoside-binding, soluble, 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LGALS12-lectin, galactoside-binding, soluble, 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028222
Product type: DNA & cDNA
Ncbi symbol: LGALS12
Origin species: Human
Product name: LGALS12-lectin, galactoside-binding, soluble, 12 Gene
Size: 2ug
Accessions: BC028222
Gene id: 85329
Gene description: lectin, galactoside-binding, soluble, 12
Synonyms: GAL12; GRIP1; galectin-12; galectin-related inhibitor of proliferation; lectin, galactoside-binding, soluble, 12; testicular secretory protein Li 26; galectin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcagcccagtgggggcagggctcctggaacgaggatctacagttggagttgccccactgtcatgtcacctggagaaaaactggacccaattcctgacagcttcattctgcaaccaccagtcttccacccggtggttccttatgtcacgacgatttttggaggcctgcatgcaggcaagatggtcatgctgcaaggagtggtccctctagatgcacacaggtttcaggtggacttccagtgtggctgcagcctgtgtccccggccagatatcgccttccacttcaaccctcgcttccataccaccaagccccatgtcatctgcaacaccctgcatggtggacgctggcaaagggaggcccggtggccccacctggccctgcgaagaggctccagcttcctcatcctctttctcttcgggaatgaggaagtgaaggtgagtgtgaatggacagcactttctccacttccgctaccggctcccactgtctcatgtggacacgctgggtatatttggtgacatcctggtagaggctgttggattcctgaacatcaatccatttgtggagggcagcagagagtacccagctggacatcctttcctgctgatgagccccaggctggaggtgccctgctcacatgctcttccccagggtctctcgcctgggcaggtcatcatagtacggggactggtcttgcaagagccgaagcattttactgtgagcctgagggaccaggctgcccatgctcctgtgacactcagggcctccttcgcagacagaactctggcctggatctcccgctgggggcagaagaaactgatctcagcccccttcctcttttacccccagagattctttgaggtgctgctcctgttccaggagggagggctgaagctggcgctcaatgggcaggggctgggggccaccagcatgaaccagcaggccctggagcagctgcgggagctccggatcagtggaagtgtccagctctactgtgtccactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - malate dehydrogenase 2, NAD (mitochondrial)
- hydroxysteroid (17-beta) dehydrogenase 7
- mitogen-activated protein kinase kinase 3
- receptor-associated protein of the synapse

Buy LGALS12-lectin, galactoside-binding, soluble, 12 Gene now

Add to cart