Login to display prices
Login to display prices
LGALS12-lectin, galactoside-binding, soluble, 12 Gene View larger

LGALS12-lectin, galactoside-binding, soluble, 12 Gene

PTXBC028222

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LGALS12-lectin, galactoside-binding, soluble, 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LGALS12-lectin, galactoside-binding, soluble, 12 Gene

Proteogenix catalog: PTXBC028222
Ncbi symbol: LGALS12
Product name: LGALS12-lectin, galactoside-binding, soluble, 12 Gene
Size: 2ug
Accessions: BC028222
Gene id: 85329
Gene description: lectin, galactoside-binding, soluble, 12
Synonyms: GAL12; GRIP1; galectin-12; galectin-related inhibitor of proliferation; lectin, galactoside-binding, soluble, 12; testicular secretory protein Li 26; galectin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcagcccagtgggggcagggctcctggaacgaggatctacagttggagttgccccactgtcatgtcacctggagaaaaactggacccaattcctgacagcttcattctgcaaccaccagtcttccacccggtggttccttatgtcacgacgatttttggaggcctgcatgcaggcaagatggtcatgctgcaaggagtggtccctctagatgcacacaggtttcaggtggacttccagtgtggctgcagcctgtgtccccggccagatatcgccttccacttcaaccctcgcttccataccaccaagccccatgtcatctgcaacaccctgcatggtggacgctggcaaagggaggcccggtggccccacctggccctgcgaagaggctccagcttcctcatcctctttctcttcgggaatgaggaagtgaaggtgagtgtgaatggacagcactttctccacttccgctaccggctcccactgtctcatgtggacacgctgggtatatttggtgacatcctggtagaggctgttggattcctgaacatcaatccatttgtggagggcagcagagagtacccagctggacatcctttcctgctgatgagccccaggctggaggtgccctgctcacatgctcttccccagggtctctcgcctgggcaggtcatcatagtacggggactggtcttgcaagagccgaagcattttactgtgagcctgagggaccaggctgcccatgctcctgtgacactcagggcctccttcgcagacagaactctggcctggatctcccgctgggggcagaagaaactgatctcagcccccttcctcttttacccccagagattctttgaggtgctgctcctgttccaggagggagggctgaagctggcgctcaatgggcaggggctgggggccaccagcatgaaccagcaggccctggagcagctgcgggagctccggatcagtggaagtgtccagctctactgtgtccactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: