SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene View larger

SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039300
Product type: DNA & cDNA
Ncbi symbol: SRGAP3
Origin species: Human
Product name: SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene
Size: 2ug
Accessions: BC039300
Gene id: 9901
Gene description: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: ARHGAP14; MEGAP; SRGAP2; WRP; SLIT-ROBO Rho GTPase-activating protein 3; SLIT-ROBO Rho GTPase activating protein 2; WAVE-associated Rac GTPase activating protein; mental disorder-associated GAP; rho GTPase-activating protein 14; SLIT-ROBO Rho GTPase activating protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaatgtcatcgtccgcctctcccagatcagtgaggatgtcatcagactcttcaaaaagagcaaggagattggcctgcagatgcacgaggagctcctgaaggtgaccaatgagctctacacagtcatgaaaacctaccacatgtaccatgcagagagcatcagtgcggaaagcaagctgaaggaggctgagaagcaggaggagaagcagttcaataagtcaggagacctcagcatgaacctgctccggcacgaggaccggccccagcgccgcagctctgtgaagaagattgagaagatgaaggagaagaggcaggccaagtactctgagaacaagctgaaatgcacaaaggcccggaatgactacttgctcaatctggcagccaccaacgcagctataagcaaatactacatccatgatgtctctgatctgatcgattgctgtgatttgggcttccatgccagcctggcccgcaccttccggacctatctctcagctgaatacaacctggagacctctcgccacgaagggctggatgtcattgagaatgcagtggacaacctggattcccgaagtgacaagcacacagtcatggacatgtgcaatcaagtcttctgccctccactcaagttcgagttccagccccacatgggggatgaggtctgccaggtcagcgctcagcagcccgtccagacagaactgctcatgcgttatcaccagctgcagtccagactggccaccctcaagatagagaatgaggaggttaggaaaaccctggatgccaccatgcagacattacaggacatgctgactgtggaggactttgatgtctccgatgccttccaacacagtcgatcgacagagtccgtcaagtcggctgcctctgaggcctacatgagcaagatcaacattgccaagaggagagccaaccagcaggaaacagaaatgttttattttacaaacgggcctgatgatgttttccccatttgccatccaagactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lectin, galactoside-binding, soluble, 12
- malate dehydrogenase 2, NAD (mitochondrial)
- hydroxysteroid (17-beta) dehydrogenase 7
- mitogen-activated protein kinase kinase 3

Buy SRGAP3-SLIT-ROBO Rho GTPase activating protein 3 Gene now

Add to cart