MAP2K6-mitogen-activated protein kinase kinase 6 Gene View larger

MAP2K6-mitogen-activated protein kinase kinase 6 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAP2K6-mitogen-activated protein kinase kinase 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAP2K6-mitogen-activated protein kinase kinase 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012009
Product type: DNA & cDNA
Ncbi symbol: MAP2K6
Origin species: Human
Product name: MAP2K6-mitogen-activated protein kinase kinase 6 Gene
Size: 2ug
Accessions: BC012009
Gene id: 5608
Gene description: mitogen-activated protein kinase kinase 6
Synonyms: MAPKK6; MEK6; PRKMK6; SAPKK-3; SAPKK3; dual specificity mitogen-activated protein kinase kinase 6; MAPK/ERK kinase 6; MAPKK 6; MEK 6; SAPK kinase 3; protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6); stress-activated protein kinase kinase 3; mitogen-activated protein kinase kinase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcagtcgaaaggcaagaagcgaaaccctggccttaaaattccaaaagaagcatttgaacaacctcagaccagttccacaccacctcgagatttagactccaaggcttgcatttctattggaaatcagaactttgaggtgaaggcagatgacctggagcctataatggaactgggacgaggtgcgtacggggtggtggagaagatgcggcacgtgcccagcgggcagatcatggcagtgaagcggatccgagccacagtaaatagccaggaacagaaacggctactgatggatttggatatttccatgaggacggtggactgtccattcactgtcaccttttatggcgcactgtttcgggagggtgatgtgtggatctgcatggagctcatggatacatcactagataaattctacaaacaagttattgataaaggccagacaattccagaggacatcttagggaaaatagcagtttctattgtaaaagcattagaacatttacatagtaagctgtctgtcattcacagagacgtcaagccttctaatgtactcatcaatgctctcggtcaagtgaagatgtgcgattttggaatcagtggctacttggtggactctgttgctaaaacaattgatgcaggttgcaaaccatacatggcccctgaaagaataaacccagagctcaaccagaagggatacagtgtgaagtctgacatttggagtctgggcatcacgatgattgagttggccatccttcgatttccctatgattcatggggaactccatttcagcagctcaaacaggtggtagaggagccatcgccacaactcccagcagacaagttctctgcagagtttgttgactttacctcacagtgcttaaagaagaattccaaagaacggcctacatacccagagctaatgcaacatccatttttcaccctacatgaatccaaaggaacagatgtggcatcttttgtaaaactgattcttggagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SLIT-ROBO Rho GTPase activating protein 3
- lectin, galactoside-binding, soluble, 12
- malate dehydrogenase 2, NAD (mitochondrial)
- hydroxysteroid (17-beta) dehydrogenase 7

Buy MAP2K6-mitogen-activated protein kinase kinase 6 Gene now

Add to cart